Incidental Mutation 'R4933:Aurkb'
ID380731
Institutional Source Beutler Lab
Gene Symbol Aurkb
Ensembl Gene ENSMUSG00000020897
Gene Nameaurora kinase B
SynonymsIPL1, Aik2, aurora B, AIRK2, Stk5, Stk12, STK-1
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4933 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69045647-69051664 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 69048144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021277] [ENSMUST00000108666]
Predicted Effect probably benign
Transcript: ENSMUST00000021277
SMART Domains Protein: ENSMUSP00000021277
Gene: ENSMUSG00000020897

DomainStartEndE-ValueType
S_TKc 82 332 2.75e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108666
SMART Domains Protein: ENSMUSP00000104306
Gene: ENSMUSG00000020897

DomainStartEndE-ValueType
S_TKc 82 332 2.75e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156373
Meta Mutation Damage Score 0.0568 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 2 and 7. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygous null mice may develop oligospermia and show premature death and increased tumor incidence. Homozygous null embryos are small and die post-implantation showing reduced inner cell mass outgrowth, mitotic defects, aberrant trophoblast giant cells, edema, hemorrhage and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Aurkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Aurkb APN 11 69048779 missense probably damaging 1.00
R0193:Aurkb UTSW 11 69048544 missense probably damaging 1.00
R0924:Aurkb UTSW 11 69045996 nonsense probably null
R4622:Aurkb UTSW 11 69048362 missense probably damaging 1.00
R4664:Aurkb UTSW 11 69048609 missense probably damaging 0.98
R5243:Aurkb UTSW 11 69045926 splice site probably benign
R5705:Aurkb UTSW 11 69048815 missense possibly damaging 0.87
R6457:Aurkb UTSW 11 69048346 missense possibly damaging 0.77
R6604:Aurkb UTSW 11 69048562 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGTACCTTGGATGATGGG -3'
(R):5'- TGGATTTCGATCTCTCGGCG -3'

Sequencing Primer
(F):5'- GGATGGACTCAACATAATTCTCTCTC -3'
(R):5'- GGTGCTCTACCCCCTCC -3'
Posted On2016-04-15