Incidental Mutation 'R4934:Tacc2'
ID380809
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 042534-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4934 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130728588 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 201 (S201G)
Ref Sequence ENSEMBL: ENSMUSP00000146690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033141] [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207282] [ENSMUST00000207376] [ENSMUST00000207395] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000208722] [ENSMUST00000208743] [ENSMUST00000209108]
Predicted Effect probably benign
Transcript: ENSMUST00000033141
AA Change: S91G

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033141
Gene: ENSMUSG00000030852
AA Change: S91G

DomainStartEndE-ValueType
low complexity region 37 63 N/A INTRINSIC
internal_repeat_1 71 181 1.04e-5 PROSPERO
low complexity region 235 246 N/A INTRINSIC
internal_repeat_2 258 345 6.53e-5 PROSPERO
internal_repeat_1 373 456 1.04e-5 PROSPERO
low complexity region 461 476 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
internal_repeat_2 629 716 6.53e-5 PROSPERO
coiled coil region 763 790 N/A INTRINSIC
Pfam:TACC 829 1035 3.4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059145
AA Change: S201G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: S201G

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084513
AA Change: S1908G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: S1908G

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207282
AA Change: S91G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000207376
Predicted Effect probably benign
Transcript: ENSMUST00000207395
Predicted Effect probably benign
Transcript: ENSMUST00000207549
Predicted Effect probably damaging
Transcript: ENSMUST00000207789
AA Change: S201G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208722
AA Change: S201G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000208743
AA Change: S91G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000209108
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 99% (134/135)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik A T 1: 31,222,499 probably benign Het
Acy1 T A 9: 106,435,122 I14F probably null Het
Ago1 T C 4: 126,448,859 D193G possibly damaging Het
Arhgap45 A T 10: 80,020,957 H201L probably damaging Het
Armc9 G A 1: 86,213,079 D63N probably damaging Het
Asb17 A T 3: 153,850,699 I148F possibly damaging Het
Atf7ip2 A G 16: 10,241,583 E329G possibly damaging Het
Atp2a1 T A 7: 126,453,428 D373V probably benign Het
BC067074 C A 13: 113,368,348 Q2004K probably damaging Het
Cacna1e G T 1: 154,481,634 Y603* probably null Het
Cbln4 G A 2: 172,038,981 T131I probably damaging Het
Ccdc126 A G 6: 49,334,247 E63G probably damaging Het
Ccl4 T A 11: 83,662,678 S6T unknown Het
Ccnb1 A T 13: 100,781,701 I146K possibly damaging Het
Ccr8 T A 9: 120,094,749 M310K probably benign Het
Cd180 A T 13: 102,739,164 probably null Het
Cd46 G C 1: 195,082,799 probably benign Het
Cebpb A G 2: 167,689,085 M22V probably benign Het
Cep152 A G 2: 125,611,096 I352T possibly damaging Het
Cep295 T G 9: 15,333,160 E1333D probably damaging Het
Ces4a A G 8: 105,137,981 H30R probably benign Het
Chrm3 A G 13: 9,877,414 Y529H probably damaging Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Clca3a2 A G 3: 144,817,931 Y98H probably damaging Het
Clvs1 C T 4: 9,424,216 H221Y possibly damaging Het
Col3a1 G A 1: 45,339,952 probably benign Het
Cpn2 T G 16: 30,260,526 N119T probably damaging Het
Cubn T A 2: 13,489,910 Q109H probably benign Het
Cyp26b1 A G 6: 84,576,972 V221A possibly damaging Het
Cyp2e1 T G 7: 140,770,117 N238K probably damaging Het
Dst C T 1: 34,208,588 A1693V probably damaging Het
Dync2li1 A G 17: 84,649,255 Q281R probably benign Het
Enpp2 C T 15: 54,882,147 G318S probably damaging Het
F13a1 G T 13: 36,877,762 P676T probably benign Het
Fam189a2 T C 19: 23,973,425 *597W probably null Het
Fam227a T C 15: 79,637,061 H267R possibly damaging Het
Fam78a G A 2: 32,069,415 R228C probably damaging Het
Fbxw25 T C 9: 109,651,637 N325S possibly damaging Het
Foxred1 T C 9: 35,209,914 probably benign Het
Fstl5 T A 3: 76,588,965 V345E probably damaging Het
Fzd8 GAAAAACTCA GA 18: 9,214,492 probably null Het
Gm15448 A G 7: 3,822,677 Y398H probably damaging Het
Hand1 T C 11: 57,831,252 R179G possibly damaging Het
Hk1 G T 10: 62,358,386 probably benign Het
Hmcn1 A C 1: 150,722,535 L1672R probably damaging Het
Hps5 G A 7: 46,769,351 Q297* probably null Het
Iars T A 13: 49,717,984 F699I probably benign Het
Ift140 G A 17: 25,048,488 G620E probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4a T G 1: 37,387,841 Y628D possibly damaging Het
Itk C T 11: 46,389,325 R29H probably damaging Het
Kcnv1 A G 15: 45,109,248 F413S probably damaging Het
Klhl3 A T 13: 58,102,417 Y4* probably null Het
Lonrf1 C A 8: 36,233,949 C369F probably damaging Het
Magohb A T 6: 131,284,595 probably benign Het
Map3k4 G A 17: 12,271,900 R215C probably damaging Het
Map3k8 A T 18: 4,339,548 S274R possibly damaging Het
Masp1 T G 16: 23,465,076 M470L probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Muc4 A T 16: 32,756,098 probably benign Het
Myo1c T A 11: 75,671,850 V981E probably damaging Het
Nedd9 A T 13: 41,338,935 I27K probably damaging Het
Nkd2 C A 13: 73,822,722 G247V probably damaging Het
Nucb2 A C 7: 116,539,964 Q398P possibly damaging Het
Numa1 T A 7: 102,010,857 D376E probably benign Het
Olfr1188 C T 2: 88,559,586 T39I probably benign Het
Olfr1198 A T 2: 88,746,054 L278* probably null Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr263 G A 13: 21,133,071 V99I probably benign Het
Olfr722 T C 14: 49,895,749 T18A probably benign Het
Olfr735 C T 14: 50,345,888 V185M probably damaging Het
Olfr813 A T 10: 129,857,027 N170Y possibly damaging Het
Olfr930 A T 9: 38,930,833 I221F probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcnx G A 12: 81,991,825 V1955I possibly damaging Het
Plekha3 T A 2: 76,680,227 D35E possibly damaging Het
Pnpla2 T G 7: 141,458,172 N184K probably damaging Het
Polr3a C T 14: 24,452,624 E1216K probably benign Het
Ppp1r21 A T 17: 88,545,375 S61C probably damaging Het
Ppp1r21 G C 17: 88,545,376 S61T probably damaging Het
Prdm13 G T 4: 21,678,223 probably benign Het
Prss53 T C 7: 127,888,707 N201S probably benign Het
Rab11fip2 A G 19: 59,935,858 L338S probably damaging Het
Rad50 T C 11: 53,684,275 N546S probably benign Het
Ralgapa1 T C 12: 55,762,574 D472G possibly damaging Het
Rexo4 A G 2: 26,960,334 I277T probably damaging Het
Rimbp2 C T 5: 128,788,515 V590I probably benign Het
Ripor3 A G 2: 167,982,816 V864A probably benign Het
Rnpc3 G A 3: 113,624,979 H107Y possibly damaging Het
Ryr1 A T 7: 29,068,095 D2927E probably damaging Het
Samd9l G A 6: 3,375,621 Q547* probably null Het
Scaper T C 9: 55,809,175 E724G probably damaging Het
Secisbp2l C T 2: 125,740,489 V1016I probably damaging Het
Selenoo T A 15: 89,098,767 M499K probably damaging Het
Sema4a T A 3: 88,438,261 D505V probably damaging Het
Sema5a T C 15: 32,679,164 M863T probably damaging Het
Slc24a5 T C 2: 125,088,020 C414R probably damaging Het
Slc34a2 A G 5: 53,067,600 D361G probably damaging Het
Slc5a1 T C 5: 33,104,514 Y20H probably benign Het
Slx4ip A T 2: 137,068,347 probably benign Het
Snx14 T A 9: 88,398,288 E538V probably damaging Het
Sspo C A 6: 48,465,552 L1994I probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stap2 A G 17: 55,997,901 S294P possibly damaging Het
Stat1 C A 1: 52,153,923 Y651* probably null Het
Syne2 A G 12: 75,899,272 T373A probably benign Het
Tdpoz3 G A 3: 93,826,980 E321K probably benign Het
Thumpd1 T C 7: 119,716,779 T316A probably benign Het
Tlr3 A T 8: 45,397,035 C866S probably benign Het
Tmprss11g T A 5: 86,496,542 I148F probably benign Het
Topbp1 T A 9: 103,328,369 probably benign Het
Tpm1 T C 9: 67,028,049 probably null Het
Traf3ip2 T A 10: 39,626,100 S81R probably damaging Het
Trim29 T A 9: 43,310,968 N31K probably benign Het
Ubn2 C T 6: 38,490,498 P563S probably benign Het
Usp24 T C 4: 106,426,546 Y2418H probably benign Het
Vmn2r6 T A 3: 64,556,345 D267V probably damaging Het
Wapl T A 14: 34,692,095 C305S probably benign Het
Yme1l1 C A 2: 23,168,321 S155* probably null Het
Ythdf3 T A 3: 16,204,056 H126Q probably damaging Het
Zbtb32 A T 7: 30,591,253 C206S possibly damaging Het
Zfp518a A T 19: 40,914,263 I879F probably benign Het
Zfp651 T C 9: 121,763,979 V455A probably damaging Het
Zfp938 A T 10: 82,226,178 Y203N possibly damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGTTTATCAACCTCTGCTCTG -3'
(R):5'- TGGCTTGTAGGCTAAGCGAAC -3'

Sequencing Primer
(F):5'- ATCAACCTCTGCTCTGTGGAGTG -3'
(R):5'- ACGGACTCGGTGGATTTCCTC -3'
Posted On2016-04-15