Incidental Mutation 'R4934:Syne2'
ID380840
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Namespectrin repeat containing, nuclear envelope 2
Synonymssyne-2, D12Ertd777e, nesprin-2, 6820443O06Rik, Nesp2g
MMRRC Submission 042534-MU
Accession Numbers

Genbank: NM_001005510

Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R4934 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location75818134-76110926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75899272 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 373 (T373A)
Ref Sequence ENSEMBL: ENSMUSP00000047697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000143031] [ENSMUST00000150317]
Predicted Effect probably benign
Transcript: ENSMUST00000044217
AA Change: T373A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: T373A

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143031
AA Change: T373A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: T373A

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150317
AA Change: T373A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000118142
Gene: ENSMUSG00000063450
AA Change: T373A

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
Blast:SPEC 394 493 2e-27 BLAST
low complexity region 494 505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157033
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 99% (134/135)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik A T 1: 31,222,499 probably benign Het
Acy1 T A 9: 106,435,122 I14F probably null Het
Ago1 T C 4: 126,448,859 D193G possibly damaging Het
Arhgap45 A T 10: 80,020,957 H201L probably damaging Het
Armc9 G A 1: 86,213,079 D63N probably damaging Het
Asb17 A T 3: 153,850,699 I148F possibly damaging Het
Atf7ip2 A G 16: 10,241,583 E329G possibly damaging Het
Atp2a1 T A 7: 126,453,428 D373V probably benign Het
BC067074 C A 13: 113,368,348 Q2004K probably damaging Het
Cacna1e G T 1: 154,481,634 Y603* probably null Het
Cbln4 G A 2: 172,038,981 T131I probably damaging Het
Ccdc126 A G 6: 49,334,247 E63G probably damaging Het
Ccl4 T A 11: 83,662,678 S6T unknown Het
Ccnb1 A T 13: 100,781,701 I146K possibly damaging Het
Ccr8 T A 9: 120,094,749 M310K probably benign Het
Cd180 A T 13: 102,739,164 probably null Het
Cd46 G C 1: 195,082,799 probably benign Het
Cebpb A G 2: 167,689,085 M22V probably benign Het
Cep152 A G 2: 125,611,096 I352T possibly damaging Het
Cep295 T G 9: 15,333,160 E1333D probably damaging Het
Ces4a A G 8: 105,137,981 H30R probably benign Het
Chrm3 A G 13: 9,877,414 Y529H probably damaging Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Clca3a2 A G 3: 144,817,931 Y98H probably damaging Het
Clvs1 C T 4: 9,424,216 H221Y possibly damaging Het
Col3a1 G A 1: 45,339,952 probably benign Het
Cpn2 T G 16: 30,260,526 N119T probably damaging Het
Cubn T A 2: 13,489,910 Q109H probably benign Het
Cyp26b1 A G 6: 84,576,972 V221A possibly damaging Het
Cyp2e1 T G 7: 140,770,117 N238K probably damaging Het
Dst C T 1: 34,208,588 A1693V probably damaging Het
Dync2li1 A G 17: 84,649,255 Q281R probably benign Het
Enpp2 C T 15: 54,882,147 G318S probably damaging Het
F13a1 G T 13: 36,877,762 P676T probably benign Het
Fam189a2 T C 19: 23,973,425 *597W probably null Het
Fam227a T C 15: 79,637,061 H267R possibly damaging Het
Fam78a G A 2: 32,069,415 R228C probably damaging Het
Fbxw25 T C 9: 109,651,637 N325S possibly damaging Het
Foxred1 T C 9: 35,209,914 probably benign Het
Fstl5 T A 3: 76,588,965 V345E probably damaging Het
Fzd8 GAAAAACTCA GA 18: 9,214,492 probably null Het
Gm15448 A G 7: 3,822,677 Y398H probably damaging Het
Hand1 T C 11: 57,831,252 R179G possibly damaging Het
Hk1 G T 10: 62,358,386 probably benign Het
Hmcn1 A C 1: 150,722,535 L1672R probably damaging Het
Hps5 G A 7: 46,769,351 Q297* probably null Het
Iars T A 13: 49,717,984 F699I probably benign Het
Ift140 G A 17: 25,048,488 G620E probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4a T G 1: 37,387,841 Y628D possibly damaging Het
Itk C T 11: 46,389,325 R29H probably damaging Het
Kcnv1 A G 15: 45,109,248 F413S probably damaging Het
Klhl3 A T 13: 58,102,417 Y4* probably null Het
Lonrf1 C A 8: 36,233,949 C369F probably damaging Het
Magohb A T 6: 131,284,595 probably benign Het
Map3k4 G A 17: 12,271,900 R215C probably damaging Het
Map3k8 A T 18: 4,339,548 S274R possibly damaging Het
Masp1 T G 16: 23,465,076 M470L probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Muc4 A T 16: 32,756,098 probably benign Het
Myo1c T A 11: 75,671,850 V981E probably damaging Het
Nedd9 A T 13: 41,338,935 I27K probably damaging Het
Nkd2 C A 13: 73,822,722 G247V probably damaging Het
Nucb2 A C 7: 116,539,964 Q398P possibly damaging Het
Numa1 T A 7: 102,010,857 D376E probably benign Het
Olfr1188 C T 2: 88,559,586 T39I probably benign Het
Olfr1198 A T 2: 88,746,054 L278* probably null Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr263 G A 13: 21,133,071 V99I probably benign Het
Olfr722 T C 14: 49,895,749 T18A probably benign Het
Olfr735 C T 14: 50,345,888 V185M probably damaging Het
Olfr813 A T 10: 129,857,027 N170Y possibly damaging Het
Olfr930 A T 9: 38,930,833 I221F probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcnx G A 12: 81,991,825 V1955I possibly damaging Het
Plekha3 T A 2: 76,680,227 D35E possibly damaging Het
Pnpla2 T G 7: 141,458,172 N184K probably damaging Het
Polr3a C T 14: 24,452,624 E1216K probably benign Het
Ppp1r21 A T 17: 88,545,375 S61C probably damaging Het
Ppp1r21 G C 17: 88,545,376 S61T probably damaging Het
Prdm13 G T 4: 21,678,223 probably benign Het
Prss53 T C 7: 127,888,707 N201S probably benign Het
Rab11fip2 A G 19: 59,935,858 L338S probably damaging Het
Rad50 T C 11: 53,684,275 N546S probably benign Het
Ralgapa1 T C 12: 55,762,574 D472G possibly damaging Het
Rexo4 A G 2: 26,960,334 I277T probably damaging Het
Rimbp2 C T 5: 128,788,515 V590I probably benign Het
Ripor3 A G 2: 167,982,816 V864A probably benign Het
Rnpc3 G A 3: 113,624,979 H107Y possibly damaging Het
Ryr1 A T 7: 29,068,095 D2927E probably damaging Het
Samd9l G A 6: 3,375,621 Q547* probably null Het
Scaper T C 9: 55,809,175 E724G probably damaging Het
Secisbp2l C T 2: 125,740,489 V1016I probably damaging Het
Selenoo T A 15: 89,098,767 M499K probably damaging Het
Sema4a T A 3: 88,438,261 D505V probably damaging Het
Sema5a T C 15: 32,679,164 M863T probably damaging Het
Slc24a5 T C 2: 125,088,020 C414R probably damaging Het
Slc34a2 A G 5: 53,067,600 D361G probably damaging Het
Slc5a1 T C 5: 33,104,514 Y20H probably benign Het
Slx4ip A T 2: 137,068,347 probably benign Het
Snx14 T A 9: 88,398,288 E538V probably damaging Het
Sspo C A 6: 48,465,552 L1994I probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stap2 A G 17: 55,997,901 S294P possibly damaging Het
Stat1 C A 1: 52,153,923 Y651* probably null Het
Tacc2 A G 7: 130,728,588 S201G probably damaging Het
Tdpoz3 G A 3: 93,826,980 E321K probably benign Het
Thumpd1 T C 7: 119,716,779 T316A probably benign Het
Tlr3 A T 8: 45,397,035 C866S probably benign Het
Tmprss11g T A 5: 86,496,542 I148F probably benign Het
Topbp1 T A 9: 103,328,369 probably benign Het
Tpm1 T C 9: 67,028,049 probably null Het
Traf3ip2 T A 10: 39,626,100 S81R probably damaging Het
Trim29 T A 9: 43,310,968 N31K probably benign Het
Ubn2 C T 6: 38,490,498 P563S probably benign Het
Usp24 T C 4: 106,426,546 Y2418H probably benign Het
Vmn2r6 T A 3: 64,556,345 D267V probably damaging Het
Wapl T A 14: 34,692,095 C305S probably benign Het
Yme1l1 C A 2: 23,168,321 S155* probably null Het
Ythdf3 T A 3: 16,204,056 H126Q probably damaging Het
Zbtb32 A T 7: 30,591,253 C206S possibly damaging Het
Zfp518a A T 19: 40,914,263 I879F probably benign Het
Zfp651 T C 9: 121,763,979 V455A probably damaging Het
Zfp938 A T 10: 82,226,178 Y203N possibly damaging Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76031700 unclassified probably benign
IGL00595:Syne2 APN 12 75925646 missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76064184 missense probably damaging 1.00
IGL00781:Syne2 APN 12 76024062 missense probably benign 0.00
IGL00823:Syne2 APN 12 75989242 missense probably damaging 0.98
IGL01014:Syne2 APN 12 75905277 missense probably damaging 0.99
IGL01074:Syne2 APN 12 76031587 nonsense probably null
IGL01074:Syne2 APN 12 75987011 missense probably benign 0.00
IGL01324:Syne2 APN 12 76043752 missense probably damaging 1.00
IGL01325:Syne2 APN 12 75926514 missense probably benign 0.01
IGL01331:Syne2 APN 12 75929253 splice site probably benign
IGL01338:Syne2 APN 12 76060226 missense possibly damaging 0.55
IGL01373:Syne2 APN 12 75987107 missense probably damaging 1.00
IGL01446:Syne2 APN 12 76041375 missense probably damaging 1.00
IGL01556:Syne2 APN 12 76087815 missense probably damaging 1.00
IGL01585:Syne2 APN 12 75949060 critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76004603 missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75909336 missense probably benign
IGL01935:Syne2 APN 12 75925313 missense probably damaging 1.00
IGL01941:Syne2 APN 12 75967220 missense probably benign 0.01
IGL01956:Syne2 APN 12 76097974 missense probably damaging 1.00
IGL01967:Syne2 APN 12 75941303 missense probably damaging 1.00
IGL01990:Syne2 APN 12 76054933 missense probably damaging 1.00
IGL02000:Syne2 APN 12 76015645 missense probably damaging 0.99
IGL02063:Syne2 APN 12 76052100 missense probably damaging 0.96
IGL02069:Syne2 APN 12 75927412 missense probably benign 0.13
IGL02120:Syne2 APN 12 75946706 missense probably damaging 1.00
IGL02222:Syne2 APN 12 75952843 missense probably damaging 0.96
IGL02223:Syne2 APN 12 76108305 missense probably benign 0.00
IGL02321:Syne2 APN 12 75918999 missense possibly damaging 0.58
IGL02488:Syne2 APN 12 75965738 missense probably benign 0.24
IGL02491:Syne2 APN 12 76072179 missense probably benign 0.10
IGL02525:Syne2 APN 12 76101003 missense probably damaging 0.99
IGL02578:Syne2 APN 12 76022279 missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76096994 missense probably damaging 1.00
IGL02702:Syne2 APN 12 76097924 missense probably damaging 1.00
IGL02726:Syne2 APN 12 76015582 missense probably damaging 0.99
IGL02795:Syne2 APN 12 75966549 missense probably damaging 0.99
IGL02803:Syne2 APN 12 76031546 missense probably damaging 1.00
IGL02814:Syne2 APN 12 75945376 missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75929337 missense probably benign 0.00
IGL03131:Syne2 APN 12 76057490 missense probably damaging 1.00
IGL03152:Syne2 APN 12 75965712 missense probably benign 0.12
IGL03216:Syne2 APN 12 75942961 splice site probably benign
IGL03228:Syne2 APN 12 75979912 missense probably benign 0.01
IGL03259:Syne2 APN 12 75989079 missense probably benign 0.05
IGL03374:Syne2 APN 12 76074586 missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75925435 missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75930632 missense probably benign 0.02
B5639:Syne2 UTSW 12 75929790 missense probably benign
K3955:Syne2 UTSW 12 75930665 missense probably damaging 1.00
P0026:Syne2 UTSW 12 75880220 splice site probably benign
R0089:Syne2 UTSW 12 75963876 missense probably damaging 1.00
R0110:Syne2 UTSW 12 76097960 nonsense probably null
R0113:Syne2 UTSW 12 75930578 missense probably damaging 1.00
R0113:Syne2 UTSW 12 76033722 missense probably damaging 1.00
R0141:Syne2 UTSW 12 75941298 missense probably damaging 1.00
R0211:Syne2 UTSW 12 76097957 missense probably damaging 1.00
R0219:Syne2 UTSW 12 76042004 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0279:Syne2 UTSW 12 76095613 missense probably damaging 1.00
R0319:Syne2 UTSW 12 76064162 missense probably damaging 0.99
R0325:Syne2 UTSW 12 75962641 missense probably benign 0.00
R0329:Syne2 UTSW 12 75966953 missense probably benign
R0330:Syne2 UTSW 12 75966953 missense probably benign
R0361:Syne2 UTSW 12 75918610 missense probably benign 0.22
R0363:Syne2 UTSW 12 76072207 missense probably damaging 0.98
R0367:Syne2 UTSW 12 75880177 missense probably damaging 1.00
R0371:Syne2 UTSW 12 75933845 missense probably damaging 1.00
R0374:Syne2 UTSW 12 75921226 nonsense probably null
R0388:Syne2 UTSW 12 75986975 missense probably benign 0.41
R0411:Syne2 UTSW 12 76059584 splice site probably null
R0432:Syne2 UTSW 12 75949064 missense probably damaging 0.99
R0469:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0492:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0496:Syne2 UTSW 12 76038940 missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76033591 splice site probably benign
R0505:Syne2 UTSW 12 76099464 missense probably damaging 1.00
R0510:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0518:Syne2 UTSW 12 76108862 critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76024121 missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75931004 missense probably benign 0.00
R0557:Syne2 UTSW 12 75929301 missense probably benign 0.04
R0567:Syne2 UTSW 12 75890230 missense probably damaging 0.98
R0599:Syne2 UTSW 12 76097960 nonsense probably null
R0602:Syne2 UTSW 12 76097960 nonsense probably null
R0608:Syne2 UTSW 12 75963813 missense probably damaging 1.00
R0614:Syne2 UTSW 12 75912353 unclassified probably null
R0636:Syne2 UTSW 12 75930983 missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75888203 missense probably benign
R0654:Syne2 UTSW 12 76097960 nonsense probably null
R0658:Syne2 UTSW 12 76094336 missense probably damaging 1.00
R0666:Syne2 UTSW 12 75923013 missense probably damaging 0.99
R0707:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0714:Syne2 UTSW 12 76097960 nonsense probably null
R0841:Syne2 UTSW 12 76074435 splice site probably benign
R0848:Syne2 UTSW 12 76097959 frame shift probably null
R0848:Syne2 UTSW 12 76097960 nonsense probably null
R1077:Syne2 UTSW 12 76042035 missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76109835 missense probably benign 0.00
R1144:Syne2 UTSW 12 75966524 missense probably benign 0.04
R1194:Syne2 UTSW 12 75934513 missense probably damaging 1.00
R1247:Syne2 UTSW 12 75967490 missense probably benign 0.39
R1276:Syne2 UTSW 12 75941189 critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76033643 missense probably damaging 1.00
R1442:Syne2 UTSW 12 75946715 missense probably damaging 1.00
R1448:Syne2 UTSW 12 76020325 splice site probably null
R1448:Syne2 UTSW 12 76052178 missense possibly damaging 0.56
R1522:Syne2 UTSW 12 76103783 missense probably damaging 0.98
R1528:Syne2 UTSW 12 75966100 missense probably benign 0.00
R1636:Syne2 UTSW 12 76004732 missense probably benign 0.01
R1637:Syne2 UTSW 12 75996002 missense probably damaging 1.00
R1650:Syne2 UTSW 12 75904259 nonsense probably null
R1654:Syne2 UTSW 12 76101094 missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76054939 missense probably benign 0.26
R1750:Syne2 UTSW 12 76052805 missense probably damaging 1.00
R1772:Syne2 UTSW 12 75938729 missense probably benign 0.19
R1797:Syne2 UTSW 12 75963783 missense probably benign 0.00
R1830:Syne2 UTSW 12 76109862 missense probably damaging 1.00
R1837:Syne2 UTSW 12 75967660 missense probably damaging 0.99
R1908:Syne2 UTSW 12 76094279 critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75899246 missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76074544 missense probably damaging 1.00
R1950:Syne2 UTSW 12 75952870 missense probably benign
R1958:Syne2 UTSW 12 75969545 missense probably benign 0.11
R2018:Syne2 UTSW 12 76074579 missense probably damaging 1.00
R2037:Syne2 UTSW 12 76025569 missense probably benign 0.04
R2067:Syne2 UTSW 12 75888342 critical splice donor site probably null
R2073:Syne2 UTSW 12 76015579 missense possibly damaging 0.54
R2099:Syne2 UTSW 12 75979973 missense probably benign 0.06
R2102:Syne2 UTSW 12 76028079 missense probably benign 0.01
R2134:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2135:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2157:Syne2 UTSW 12 76094456 missense probably damaging 1.00
R2173:Syne2 UTSW 12 76100989 splice site probably benign
R2248:Syne2 UTSW 12 76096904 missense probably damaging 1.00
R2276:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76095537 missense probably damaging 1.00
R2877:Syne2 UTSW 12 76000831 missense probably benign 0.00
R2884:Syne2 UTSW 12 75963759 missense probably benign 0.00
R3119:Syne2 UTSW 12 75909284 missense probably benign 0.01
R3499:Syne2 UTSW 12 76054978 splice site probably null
R3827:Syne2 UTSW 12 75987031 missense probably benign 0.02
R3847:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3849:Syne2 UTSW 12 76046065 nonsense probably null
R3850:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3859:Syne2 UTSW 12 75929784 missense possibly damaging 0.55
R3861:Syne2 UTSW 12 75966479 missense probably damaging 0.98
R4078:Syne2 UTSW 12 76035624 missense probably damaging 1.00
R4116:Syne2 UTSW 12 75931079 missense probably damaging 1.00
R4326:Syne2 UTSW 12 75952742 missense probably damaging 1.00
R4335:Syne2 UTSW 12 76028092 missense probably damaging 1.00
R4410:Syne2 UTSW 12 76094393 missense probably damaging 1.00
R4412:Syne2 UTSW 12 76106060 missense probably benign 0.01
R4444:Syne2 UTSW 12 76023030 missense probably damaging 1.00
R4595:Syne2 UTSW 12 75967071 missense possibly damaging 0.88
R4604:Syne2 UTSW 12 75967710 missense probably damaging 0.99
R4606:Syne2 UTSW 12 75989253 missense probably damaging 1.00
R4651:Syne2 UTSW 12 75989239 missense probably damaging 0.99
R4656:Syne2 UTSW 12 76031373 missense probably damaging 1.00
R4675:Syne2 UTSW 12 75949301 missense probably damaging 1.00
R4790:Syne2 UTSW 12 76020391 missense probably benign 0.19
R4791:Syne2 UTSW 12 75909244 missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75899167 missense probably benign 0.04
R4836:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4880:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4881:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4899:Syne2 UTSW 12 75854101 missense probably benign 0.03
R4981:Syne2 UTSW 12 75941219 missense probably damaging 0.98
R4996:Syne2 UTSW 12 75943950 missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75909131 unclassified probably benign
R5066:Syne2 UTSW 12 75966551 missense probably benign 0.05
R5095:Syne2 UTSW 12 75952826 missense probably damaging 0.99
R5151:Syne2 UTSW 12 76043710 missense probably benign 0.06
R5193:Syne2 UTSW 12 76094420 missense probably damaging 1.00
R5267:Syne2 UTSW 12 75938741 missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76099338 missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76059439 missense probably damaging 0.98
R5434:Syne2 UTSW 12 75971875 missense probably damaging 1.00
R5441:Syne2 UTSW 12 75989143 missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75888172 missense probably benign 0.13
R5497:Syne2 UTSW 12 75880389 missense probably benign 0.19
R5506:Syne2 UTSW 12 75938721 missense probably benign 0.01
R5509:Syne2 UTSW 12 75921244 missense probably damaging 1.00
R5518:Syne2 UTSW 12 75945170 missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76094458 nonsense probably null
R5581:Syne2 UTSW 12 75945085 missense probably benign 0.01
R5625:Syne2 UTSW 12 76095112 missense probably benign 0.06
R5642:Syne2 UTSW 12 75918532 missense probably damaging 1.00
R5665:Syne2 UTSW 12 76108217 critical splice donor site probably null
R5666:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5670:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5691:Syne2 UTSW 12 76027856 frame shift probably null
R5696:Syne2 UTSW 12 75994145 missense probably benign 0.00
R5720:Syne2 UTSW 12 75967667 missense probably benign 0.03
R5739:Syne2 UTSW 12 75997465 missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75880291 intron probably null
R5846:Syne2 UTSW 12 76028124 missense probably benign 0.01
R5850:Syne2 UTSW 12 76097975 missense probably damaging 1.00
R5889:Syne2 UTSW 12 76072252 nonsense probably null
R5912:Syne2 UTSW 12 75908947 critical splice donor site probably null
R5931:Syne2 UTSW 12 76008865 missense probably benign 0.37
R5985:Syne2 UTSW 12 75966159 missense probably damaging 0.96
R5988:Syne2 UTSW 12 75929417 critical splice donor site probably null
R5990:Syne2 UTSW 12 76024144 missense probably benign 0.10
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6132:Syne2 UTSW 12 75945147 missense probably benign 0.14
R6136:Syne2 UTSW 12 75905325 missense probably benign 0.24
R6229:Syne2 UTSW 12 75921220 missense probably benign 0.00
R6252:Syne2 UTSW 12 75969436 missense probably benign 0.39
R6271:Syne2 UTSW 12 75890381 missense probably damaging 1.00
R6320:Syne2 UTSW 12 76061650 missense probably damaging 0.96
R6339:Syne2 UTSW 12 75989153 missense probably benign 0.34
R6380:Syne2 UTSW 12 76104980 missense probably damaging 0.98
R6394:Syne2 UTSW 12 75990495 missense probably benign 0.09
R6419:Syne2 UTSW 12 76096966 missense probably damaging 1.00
R6426:Syne2 UTSW 12 75923083 missense probably null 0.97
R6434:Syne2 UTSW 12 76041456 missense probably damaging 0.99
R6437:Syne2 UTSW 12 75990414 missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75943901 missense probably damaging 0.97
R6501:Syne2 UTSW 12 76027847 unclassified probably null
R6552:Syne2 UTSW 12 75890241 missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76074447 missense probably damaging 1.00
R6810:Syne2 UTSW 12 75942885 missense probably benign 0.00
R6831:Syne2 UTSW 12 75966794 missense probably benign 0.39
R6861:Syne2 UTSW 12 75909266 missense probably damaging 1.00
R6875:Syne2 UTSW 12 76035630 missense probably damaging 0.99
R6892:Syne2 UTSW 12 75962528 missense probably damaging 0.98
R6906:Syne2 UTSW 12 75995986 missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76064195 missense probably benign 0.04
R6925:Syne2 UTSW 12 75854132 missense possibly damaging 0.58
R6949:Syne2 UTSW 12 75965997 missense probably benign 0.00
R6952:Syne2 UTSW 12 75927431 missense possibly damaging 0.76
X0019:Syne2 UTSW 12 75973287 missense probably benign 0.41
X0026:Syne2 UTSW 12 76101016 missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75927511 critical splice donor site probably null
X0066:Syne2 UTSW 12 76096927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTTAGGTAGCAGATTGCG -3'
(R):5'- TGATGGCCAACGTAGCTTTG -3'

Sequencing Primer
(F):5'- GCAGATTGCGTCTTATAAATGGAATG -3'
(R):5'- GGCCAACGTAGCTTTGGATAATC -3'
Posted On2016-04-15