Incidental Mutation 'R0399:Rtn3'
ID38089
Institutional Source Beutler Lab
Gene Symbol Rtn3
Ensembl Gene ENSMUSG00000024758
Gene Namereticulon 3
Synonyms
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0399 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7425901-7483289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7457876 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 231 (D231E)
Ref Sequence ENSEMBL: ENSMUSP00000085496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065304
AA Change: D250E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758
AA Change: D250E

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088169
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088171
AA Change: D231E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758
AA Change: D231E

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Rtn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Rtn3 APN 19 7435069 missense probably damaging 1.00
IGL01025:Rtn3 APN 19 7483041 missense unknown
IGL01347:Rtn3 APN 19 7457280 missense probably benign 0.01
IGL01845:Rtn3 APN 19 7457876 missense probably damaging 1.00
IGL02217:Rtn3 APN 19 7435084 missense probably damaging 0.99
IGL03024:Rtn3 APN 19 7483090 utr 5 prime probably benign
R0633:Rtn3 UTSW 19 7457593 missense probably benign 0.03
R0826:Rtn3 UTSW 19 7467880 intron probably benign
R1327:Rtn3 UTSW 19 7431011 missense possibly damaging 0.81
R1735:Rtn3 UTSW 19 7457911 missense probably damaging 0.96
R2093:Rtn3 UTSW 19 7456850 missense probably damaging 1.00
R3116:Rtn3 UTSW 19 7431990 missense probably damaging 1.00
R3894:Rtn3 UTSW 19 7435085 missense probably damaging 1.00
R3961:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3962:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3963:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R4161:Rtn3 UTSW 19 7483079 missense probably benign 0.38
R4960:Rtn3 UTSW 19 7456521 missense probably damaging 1.00
R5585:Rtn3 UTSW 19 7458195 missense probably benign 0.12
R5735:Rtn3 UTSW 19 7456692 missense probably damaging 0.99
R5796:Rtn3 UTSW 19 7457467 missense possibly damaging 0.48
R5807:Rtn3 UTSW 19 7456827 missense probably damaging 1.00
R5864:Rtn3 UTSW 19 7435111 missense probably damaging 1.00
R6322:Rtn3 UTSW 19 7458138 missense possibly damaging 0.60
R6703:Rtn3 UTSW 19 7435045 missense probably damaging 1.00
R6885:Rtn3 UTSW 19 7458331 missense probably benign 0.31
R6888:Rtn3 UTSW 19 7457249 missense probably benign 0.00
R6989:Rtn3 UTSW 19 7456491 missense possibly damaging 0.95
R6992:Rtn3 UTSW 19 7435124 missense probably damaging 1.00
X0060:Rtn3 UTSW 19 7432571 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCTACCGAGCAGTACAGAGGATGG -3'
(R):5'- AAAACTGGACTCACCTCAGGGGAC -3'

Sequencing Primer
(F):5'- AGGATGGGTAACGCCCTG -3'
(R):5'- TATTCCAGACAGTTTCCCAGAG -3'
Posted On2013-05-23