Incidental Mutation 'R4927:Cacna1g'
ID380922
Institutional Source Beutler Lab
Gene Symbol Cacna1g
Ensembl Gene ENSMUSG00000020866
Gene Namecalcium channel, voltage-dependent, T type, alpha 1G subunit
Synonymsa1G, Cav3.1d
MMRRC Submission 042528-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R4927 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94408391-94474198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94429147 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1401 (L1401Q)
Ref Sequence ENSEMBL: ENSMUSP00000103422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021234] [ENSMUST00000100561] [ENSMUST00000103166] [ENSMUST00000107785] [ENSMUST00000107786] [ENSMUST00000107788] [ENSMUST00000107789] [ENSMUST00000107790] [ENSMUST00000107791] [ENSMUST00000107792] [ENSMUST00000107793]
Predicted Effect probably damaging
Transcript: ENSMUST00000021234
AA Change: L1378Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021234
Gene: ENSMUSG00000020866
AA Change: L1378Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 9.2e-66 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 7.9e-46 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 3e-55 PFAM
coiled coil region 1519 1559 N/A INTRINSIC
low complexity region 1562 1573 N/A INTRINSIC
Pfam:Ion_trans 1630 1835 3e-49 PFAM
Pfam:PKD_channel 1688 1842 7.8e-11 PFAM
low complexity region 2180 2211 N/A INTRINSIC
low complexity region 2230 2246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100561
AA Change: L1401Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098127
Gene: ENSMUSG00000020866
AA Change: L1401Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
coiled coil region 1542 1582 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
Pfam:Ion_trans 1653 1858 6.2e-49 PFAM
Pfam:PKD_channel 1711 1865 1.4e-10 PFAM
low complexity region 2203 2234 N/A INTRINSIC
low complexity region 2253 2269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103166
AA Change: L1401Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099455
Gene: ENSMUSG00000020866
AA Change: L1401Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
SCOP:d1g2qa_ 1545 1589 6e-3 SMART
Pfam:Ion_trans 1646 1851 6.2e-49 PFAM
Pfam:PKD_channel 1704 1858 1.4e-10 PFAM
low complexity region 2196 2227 N/A INTRINSIC
low complexity region 2246 2262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107785
AA Change: L1378Q

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103414
Gene: ENSMUSG00000020866
AA Change: L1378Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.5e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.7e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 5.8e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2027 2042 N/A INTRINSIC
low complexity region 2084 2115 N/A INTRINSIC
low complexity region 2134 2150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107786
AA Change: L1361Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103415
Gene: ENSMUSG00000020866
AA Change: L1361Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 383 4e-60 PFAM
low complexity region 466 490 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Pfam:Ion_trans 760 946 1.6e-45 PFAM
low complexity region 1023 1034 N/A INTRINSIC
low complexity region 1046 1073 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
Pfam:Ion_trans 1273 1497 5.9e-55 PFAM
SCOP:d1g2qa_ 1505 1549 6e-3 SMART
Pfam:Ion_trans 1606 1811 6e-49 PFAM
Pfam:PKD_channel 1664 1818 1.4e-10 PFAM
low complexity region 2156 2187 N/A INTRINSIC
low complexity region 2206 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107788
AA Change: L1401Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103417
Gene: ENSMUSG00000020866
AA Change: L1401Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1574 N/A INTRINSIC
Pfam:Ion_trans 1628 1833 6.1e-49 PFAM
Pfam:PKD_channel 1686 1840 1.4e-10 PFAM
low complexity region 2178 2209 N/A INTRINSIC
low complexity region 2228 2244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107789
AA Change: L1401Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103418
Gene: ENSMUSG00000020866
AA Change: L1401Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 80 406 1.6e-76 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 742 972 3.4e-56 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1276 1549 1.5e-61 PFAM
low complexity region 1578 1589 N/A INTRINSIC
Pfam:Ion_trans 1611 1863 2.1e-56 PFAM
Pfam:PKD_channel 1703 1858 3.4e-9 PFAM
low complexity region 2289 2320 N/A INTRINSIC
low complexity region 2339 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107790
AA Change: L1378Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103419
Gene: ENSMUSG00000020866
AA Change: L1378Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
SCOP:d1g2qa_ 1522 1566 6e-3 SMART
Pfam:Ion_trans 1623 1828 6.1e-49 PFAM
Pfam:PKD_channel 1681 1835 1.4e-10 PFAM
low complexity region 2173 2204 N/A INTRINSIC
low complexity region 2223 2239 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107791
AA Change: L1378Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103420
Gene: ENSMUSG00000020866
AA Change: L1378Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 6e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2162 2193 N/A INTRINSIC
low complexity region 2212 2228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107792
AA Change: L1378Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103421
Gene: ENSMUSG00000020866
AA Change: L1378Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.9e-55 PFAM
coiled coil region 1519 1551 N/A INTRINSIC
Pfam:Ion_trans 1605 1810 6e-49 PFAM
Pfam:PKD_channel 1663 1817 1.4e-10 PFAM
low complexity region 2155 2186 N/A INTRINSIC
low complexity region 2205 2221 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107793
AA Change: L1401Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103422
Gene: ENSMUSG00000020866
AA Change: L1401Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1581 N/A INTRINSIC
Pfam:Ion_trans 1635 1840 6.1e-49 PFAM
Pfam:PKD_channel 1693 1847 1.4e-10 PFAM
low complexity region 2185 2216 N/A INTRINSIC
low complexity region 2235 2251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152811
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice display disrupted sleeping patterns, altered amounts of activity, abnormal action potentials in the brain, prolonged electrical conductance in the heart, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Cux2 A G 5: 121,877,089 I247T probably benign Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnh8 C A 17: 52,877,981 S430R probably damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Mos G A 4: 3,871,093 T241M probably damaging Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Rasgrp3 A G 17: 75,516,355 M474V probably benign Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc22a12 C A 19: 6,537,761 V388L probably benign Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Ticam2 T C 18: 46,560,779 I80M probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Cacna1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Cacna1g APN 11 94433912 missense probably benign 0.16
IGL01382:Cacna1g APN 11 94465858 missense probably damaging 1.00
IGL01694:Cacna1g APN 11 94429112 missense probably damaging 1.00
IGL01866:Cacna1g APN 11 94457111 missense probably damaging 0.99
IGL02341:Cacna1g APN 11 94462152 missense probably damaging 1.00
IGL02506:Cacna1g APN 11 94429129 missense probably damaging 0.99
IGL02706:Cacna1g APN 11 94456992 missense probably damaging 1.00
IGL02879:Cacna1g APN 11 94409605 missense probably benign 0.12
IGL03366:Cacna1g APN 11 94457151 missense probably damaging 1.00
ANU23:Cacna1g UTSW 11 94466228 critical splice acceptor site probably benign
IGL03134:Cacna1g UTSW 11 94459825 missense probably damaging 1.00
R0092:Cacna1g UTSW 11 94457264 missense probably damaging 1.00
R0123:Cacna1g UTSW 11 94409476 missense probably damaging 1.00
R0178:Cacna1g UTSW 11 94463483 missense probably damaging 1.00
R0375:Cacna1g UTSW 11 94411054 missense possibly damaging 0.79
R0389:Cacna1g UTSW 11 94459697 missense probably damaging 1.00
R0433:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R0458:Cacna1g UTSW 11 94409440 missense probably damaging 0.96
R0498:Cacna1g UTSW 11 94459859 missense probably damaging 1.00
R0629:Cacna1g UTSW 11 94409543 missense possibly damaging 0.93
R0800:Cacna1g UTSW 11 94426439 missense probably damaging 1.00
R1341:Cacna1g UTSW 11 94433756 missense probably damaging 0.99
R1457:Cacna1g UTSW 11 94459555 missense possibly damaging 0.76
R1523:Cacna1g UTSW 11 94442729 critical splice donor site probably null
R1532:Cacna1g UTSW 11 94443331 missense probably damaging 1.00
R1540:Cacna1g UTSW 11 94457039 missense probably damaging 1.00
R1652:Cacna1g UTSW 11 94427404 missense probably damaging 1.00
R1688:Cacna1g UTSW 11 94425953 missense possibly damaging 0.70
R1750:Cacna1g UTSW 11 94443292 missense probably damaging 1.00
R1751:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1767:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1847:Cacna1g UTSW 11 94466181 missense probably damaging 1.00
R1924:Cacna1g UTSW 11 94444054 missense possibly damaging 0.93
R1973:Cacna1g UTSW 11 94459777 missense possibly damaging 0.86
R2050:Cacna1g UTSW 11 94409474 missense probably damaging 1.00
R2261:Cacna1g UTSW 11 94457135 missense probably benign 0.42
R2273:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2274:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2275:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2376:Cacna1g UTSW 11 94465908 missense probably damaging 0.99
R3686:Cacna1g UTSW 11 94459090 splice site probably null
R3809:Cacna1g UTSW 11 94416096 missense probably damaging 1.00
R3875:Cacna1g UTSW 11 94437923 missense probably damaging 0.98
R4133:Cacna1g UTSW 11 94432544 missense probably damaging 1.00
R4642:Cacna1g UTSW 11 94418094 missense probably damaging 1.00
R4732:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4733:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4773:Cacna1g UTSW 11 94411472 missense possibly damaging 0.78
R4798:Cacna1g UTSW 11 94433847 missense probably damaging 1.00
R4839:Cacna1g UTSW 11 94459607 missense probably benign 0.16
R4900:Cacna1g UTSW 11 94459351 missense possibly damaging 0.78
R4930:Cacna1g UTSW 11 94444073 missense probably damaging 1.00
R5050:Cacna1g UTSW 11 94459715 missense probably damaging 1.00
R5117:Cacna1g UTSW 11 94432503 missense probably damaging 1.00
R5186:Cacna1g UTSW 11 94442848 missense probably damaging 1.00
R5364:Cacna1g UTSW 11 94416858 missense probably benign 0.29
R5512:Cacna1g UTSW 11 94444142 missense probably damaging 1.00
R5564:Cacna1g UTSW 11 94430486 missense probably damaging 1.00
R5603:Cacna1g UTSW 11 94439752 missense possibly damaging 0.76
R5682:Cacna1g UTSW 11 94459114 missense probably damaging 1.00
R5818:Cacna1g UTSW 11 94418120 missense probably damaging 1.00
R5828:Cacna1g UTSW 11 94457154 missense probably damaging 1.00
R5882:Cacna1g UTSW 11 94459819 missense probably damaging 1.00
R5884:Cacna1g UTSW 11 94437867 missense probably damaging 1.00
R6075:Cacna1g UTSW 11 94416665 missense probably damaging 1.00
R6112:Cacna1g UTSW 11 94409246 missense probably damaging 0.98
R6122:Cacna1g UTSW 11 94430171 missense probably benign 0.11
R6145:Cacna1g UTSW 11 94462261 missense probably damaging 1.00
R6362:Cacna1g UTSW 11 94439707 critical splice donor site probably null
R6415:Cacna1g UTSW 11 94463417 missense probably damaging 1.00
R6468:Cacna1g UTSW 11 94439722 missense probably damaging 1.00
R6648:Cacna1g UTSW 11 94432569 missense probably damaging 1.00
R6746:Cacna1g UTSW 11 94409427 nonsense probably null
R6764:Cacna1g UTSW 11 94413188 missense possibly damaging 0.95
R6782:Cacna1g UTSW 11 94459550 missense probably damaging 1.00
R6888:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R7148:Cacna1g UTSW 11 94465930 missense probably benign 0.32
R7181:Cacna1g UTSW 11 94415865 missense probably benign 0.21
R7183:Cacna1g UTSW 11 94439737 missense probably benign 0.04
R7193:Cacna1g UTSW 11 94409231 missense possibly damaging 0.60
R7237:Cacna1g UTSW 11 94437879 missense probably benign 0.21
R7254:Cacna1g UTSW 11 94432567 nonsense probably null
R7312:Cacna1g UTSW 11 94432557 missense probably damaging 1.00
X0001:Cacna1g UTSW 11 94409645 missense possibly damaging 0.90
X0019:Cacna1g UTSW 11 94459253 missense probably damaging 0.97
X0065:Cacna1g UTSW 11 94462425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAATTGGGTCCCTTCG -3'
(R):5'- CTGCAAGTGCCTGTTTGGAG -3'

Sequencing Primer
(F):5'- CAATTGGGTCCCTTCGAGAAG -3'
(R):5'- TGAGTGCTCACCATCTG -3'
Posted On2016-04-15