Incidental Mutation 'R4927:Kcnh8'
ID380938
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 042528-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R4927 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52877981 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 430 (S430R)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: S430R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: S430R

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cacna1g A T 11: 94,429,147 L1401Q probably damaging Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Cux2 A G 5: 121,877,089 I247T probably benign Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Mos G A 4: 3,871,093 T241M probably damaging Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Rasgrp3 A G 17: 75,516,355 M474V probably benign Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc22a12 C A 19: 6,537,761 V388L probably benign Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Ticam2 T C 18: 46,560,779 I80M probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTCAGTTGTTCAGATGGAC -3'
(R):5'- ACCAGTGCTTCTAGAATCTTCCAG -3'

Sequencing Primer
(F):5'- CTCAGTTGTTCAGATGGACATATCC -3'
(R):5'- TGGAGACTCAGTTCCCTT -3'
Posted On2016-04-15