Incidental Mutation 'R4927:Ticam2'
ID380944
Institutional Source Beutler Lab
Gene Symbol Ticam2
Ensembl Gene ENSMUSG00000056130
Gene Nametoll-like receptor adaptor molecule 2
SynonymsTirp, TRAM
MMRRC Submission 042528-MU
Accession Numbers

NCBI RefSeq: NM_173394; MGI: 3040056

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4927 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46559155-46574533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46560779 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 80 (I80M)
Ref Sequence ENSEMBL: ENSMUSP00000066239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036030] [ENSMUST00000070084]
Predicted Effect probably benign
Transcript: ENSMUST00000036030
SMART Domains Protein: ENSMUSP00000043660
Gene: ENSMUSG00000033184

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EMP24_GP25L 36 188 1.1e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070084
AA Change: I80M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066239
Gene: ENSMUSG00000056130
AA Change: I80M

DomainStartEndE-ValueType
Pfam:TIR_2 78 192 2e-10 PFAM
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TIRP is a Toll/interleukin-1 receptor (IL1R; MIM 147810) (TIR) domain-containing adaptor protein involved in Toll receptor signaling (see TLR4; MIM 603030).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous inactivation of this gene affects TLR4-mediated immune responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cacna1g A T 11: 94,429,147 L1401Q probably damaging Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Cux2 A G 5: 121,877,089 I247T probably benign Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnh8 C A 17: 52,877,981 S430R probably damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Mos G A 4: 3,871,093 T241M probably damaging Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Rasgrp3 A G 17: 75,516,355 M474V probably benign Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc22a12 C A 19: 6,537,761 V388L probably benign Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Ticam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Ticam2 APN 18 46560813 missense probably benign 0.04
Branch UTSW 18 46560651 missense probably damaging 1.00
Consequential UTSW 18 46560779 missense probably damaging 1.00
Messi UTSW 18 46560922 nonsense probably null
R0056:Ticam2 UTSW 18 46560334 missense possibly damaging 0.61
R0056:Ticam2 UTSW 18 46560334 missense possibly damaging 0.61
R0666:Ticam2 UTSW 18 46560651 missense probably damaging 1.00
R1676:Ticam2 UTSW 18 46560610 missense probably damaging 1.00
R2209:Ticam2 UTSW 18 46560400 missense probably damaging 1.00
R4928:Ticam2 UTSW 18 46560922 nonsense probably null
R6841:Ticam2 UTSW 18 46560931 missense probably benign 0.02
R7489:Ticam2 UTSW 18 46560517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGAATTCATCAGGGAAGTG -3'
(R):5'- AAGACGGCCATGAGTCAGAC -3'

Sequencing Primer
(F):5'- ACTGGAAGTTACACCAGGTGTCTC -3'
(R):5'- CTCCAAGAATTCTGAGGAAGCCTG -3'
Posted On2016-04-15