Incidental Mutation 'R4929:Stx16'
ID381069
Institutional Source Beutler Lab
Gene Symbol Stx16
Ensembl Gene ENSMUSG00000027522
Gene Namesyntaxin 16
SynonymsSYN16, 6330500A18Rik, 5430410K23Rik
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4929 (G1)
Quality Score217
Status Validated
Chromosome2
Chromosomal Location174076308-174099771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174096928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 296 (Y296H)
Ref Sequence ENSEMBL: ENSMUSP00000085218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044638] [ENSMUST00000087908] [ENSMUST00000147038] [ENSMUST00000155000]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044638
AA Change: Y297H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039543
Gene: ENSMUSG00000027522
AA Change: Y297H

DomainStartEndE-ValueType
Blast:SynN 76 190 2e-20 BLAST
t_SNARE 227 294 9.13e-23 SMART
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087908
AA Change: Y296H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085218
Gene: ENSMUSG00000027522
AA Change: Y296H

DomainStartEndE-ValueType
Pfam:Syntaxin 74 174 2.1e-15 PFAM
t_SNARE 226 293 9.13e-23 SMART
transmembrane domain 304 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147038
SMART Domains Protein: ENSMUSP00000120279
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 121 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155000
SMART Domains Protein: ENSMUSP00000119952
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 89 4.8e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156054
AA Change: Y245H
SMART Domains Protein: ENSMUSP00000116618
Gene: ENSMUSG00000027522
AA Change: Y245H

DomainStartEndE-ValueType
Blast:SynN 73 187 5e-21 BLAST
Pfam:SNARE 217 258 6.6e-18 PFAM
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and do not exhibit methylation abnormalities or develop a pseudohypoparathyroidism resistance phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Stx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Stx16 APN 2 174092409 missense probably damaging 1.00
IGL01626:Stx16 APN 2 174094020 missense probably damaging 1.00
IGL03052:Stx16 UTSW 2 174092438 missense probably benign 0.01
R0257:Stx16 UTSW 2 174096961 missense probably benign 0.39
R5728:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5729:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5746:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5772:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5774:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5776:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R6147:Stx16 UTSW 2 174090687 missense probably damaging 1.00
R6837:Stx16 UTSW 2 174094002 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TAACTTGGTGTCTCTTGGCC -3'
(R):5'- TGGTTAGAAGGTGTCCACGG -3'

Sequencing Primer
(F):5'- GGCCTCGGTCTTCACACTAG -3'
(R):5'- GTGCTCTTTACACAGTGCAGCG -3'
Posted On2016-04-15