Incidental Mutation 'R4929:4930432E11Rik'
ID381087
Institutional Source Beutler Lab
Gene Symbol 4930432E11Rik
Ensembl Gene ENSMUSG00000046958
Gene NameRIKEN cDNA 4930432E11 gene
Synonyms
MMRRC Submission 042530-MU
Accession Numbers

NCBI RefSeq: none; Ensembl: ENSMUST00000053635; MGI:3045259

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4929 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29558579-29582169 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 29574042 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053635
SMART Domains Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

DomainStartEndE-ValueType
Blast:WD40 43 79 3e-11 BLAST
WD40 131 172 1.97e2 SMART
WD40 175 214 2.24e-2 SMART
Blast:WD40 257 296 4e-15 BLAST
WD40 393 437 1.32e2 SMART
WD40 494 533 2.15e-4 SMART
low complexity region 598 617 N/A INTRINSIC
low complexity region 1082 1094 N/A INTRINSIC
low complexity region 1107 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063585
SMART Domains Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
internal_repeat_1 35 67 3.29e-5 PROSPERO
internal_repeat_1 73 102 3.29e-5 PROSPERO
low complexity region 122 135 N/A INTRINSIC
coiled coil region 161 182 N/A INTRINSIC
low complexity region 216 233 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187265
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in 4930432E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:4930432E11Rik APN 7 29574001 unclassified noncoding transcript
IGL01955:4930432E11Rik APN 7 29573995 unclassified noncoding transcript
IGL01971:4930432E11Rik APN 7 29574562 unclassified noncoding transcript
IGL02132:4930432E11Rik APN 7 29563279 unclassified noncoding transcript
IGL02484:4930432E11Rik APN 7 29563352 unclassified noncoding transcript
P0016:4930432E11Rik UTSW 7 29563112 unclassified noncoding transcript
R0051:4930432E11Rik UTSW 7 29579101 exon noncoding transcript
R0060:4930432E11Rik UTSW 7 29574170 unclassified noncoding transcript
R0094:4930432E11Rik UTSW 7 29560811 exon noncoding transcript
R0268:4930432E11Rik UTSW 7 29574602 unclassified noncoding transcript
R0423:4930432E11Rik UTSW 7 29562400 exon noncoding transcript
R0478:4930432E11Rik UTSW 7 29562589 exon noncoding transcript
R0646:4930432E11Rik UTSW 7 29561285 exon noncoding transcript
R1208:4930432E11Rik UTSW 7 29561283 exon noncoding transcript
R1778:4930432E11Rik UTSW 7 29560706 exon noncoding transcript
R1779:4930432E11Rik UTSW 7 29579166 exon noncoding transcript
R1918:4930432E11Rik UTSW 7 29574089 unclassified noncoding transcript
R2360:4930432E11Rik UTSW 7 29574789 unclassified noncoding transcript
R3736:4930432E11Rik UTSW 7 29574571 unclassified noncoding transcript
R3780:4930432E11Rik UTSW 7 29560838 exon noncoding transcript
R4427:4930432E11Rik UTSW 7 29579253 exon noncoding transcript
R4835:4930432E11Rik UTSW 7 29574901 unclassified noncoding transcript
R5042:4930432E11Rik UTSW 7 29574502 unclassified noncoding transcript
R5129:4930432E11Rik UTSW 7 29561361 exon noncoding transcript
R5371:4930432E11Rik UTSW 7 29562493 exon noncoding transcript
R5381:4930432E11Rik UTSW 7 29562968 unclassified noncoding transcript
R5586:4930432E11Rik UTSW 7 29577728 unclassified noncoding transcript
R5874:4930432E11Rik UTSW 7 29581185 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTCTTACCCACTGCTCAGAATTG -3'
(R):5'- GACTGCTTTCTGTGAGCCAG -3'

Sequencing Primer
(F):5'- ACCCACTGCTCAGAATTGTCTTC -3'
(R):5'- GCCTTATTAGCCCCAGATAGG -3'
Posted On2016-04-15