Mutagenetix > Incidental Mutation

Incidental Mutation 'R4929:Slfn10-ps'

381101

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

042530-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82919681-82926992 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 82920345 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,273,467 (GRCm39)		noncoding transcript	Het
Abcd3	A	T	3: 121,562,395 (GRCm39)		probably null	Het
Adamts12	C	T	15: 11,259,108 (GRCm39)	R551C	probably damaging	Het
Adamtsl4	A	G	3: 95,585,315 (GRCm39)	C818R	probably damaging	Het
Arfgef3	T	A	10: 18,506,599 (GRCm39)	Q842L	probably benign	Het
Aurka	A	T	2: 172,212,326 (GRCm39)	V17E	probably benign	Het
Cdh24	C	T	14: 54,870,973 (GRCm39)	V132I	probably benign	Het
Cep57l1	T	C	10: 41,621,910 (GRCm39)	D2G	possibly damaging	Het
Cntn5	T	A	9: 9,976,400 (GRCm39)		probably null	Het
Col10a1	T	C	10: 34,271,120 (GRCm39)	I364T	probably benign	Het
Dpp6	G	A	5: 27,254,785 (GRCm39)	A67T	probably benign	Het
Dym	T	A	18: 75,376,357 (GRCm39)	V583E	probably damaging	Het
Efcab5	T	G	11: 76,994,209 (GRCm39)	K1259N	probably benign	Het
Ehbp1	T	G	11: 22,189,169 (GRCm39)	I78L	possibly damaging	Het
Epha1	C	A	6: 42,341,533 (GRCm39)	A469S	probably benign	Het
Fam135a	T	C	1: 24,069,081 (GRCm39)	D596G	probably benign	Het
Filip1	T	C	9: 79,727,029 (GRCm39)	N530S	probably benign	Het
Gm57858	G	A	3: 36,089,487 (GRCm39)	L146F	probably damaging	Het
Grhl2	A	G	15: 37,361,046 (GRCm39)	N610S	probably benign	Het
Haus6	T	C	4: 86,513,670 (GRCm39)	I331V	probably benign	Het
Ints2	G	T	11: 86,103,479 (GRCm39)	N1192K	possibly damaging	Het
Itga5	A	G	15: 103,261,662 (GRCm39)	V445A	probably benign	Het
Itga9	C	A	9: 118,636,317 (GRCm39)	D82E	probably damaging	Het
Jam2	G	A	16: 84,619,750 (GRCm39)		probably benign	Het
Klhl32	T	A	4: 24,709,030 (GRCm39)	I112F	probably damaging	Het
Lepr	A	G	4: 101,672,314 (GRCm39)	I1113V	probably benign	Het
Lrrc3b	C	A	14: 15,357,888 (GRCm38)	L239F	probably damaging	Het
Lzic	T	A	4: 149,572,585 (GRCm39)		probably null	Het
Mxra8	T	A	4: 155,927,118 (GRCm39)	F351I	probably damaging	Het
Naa40	A	G	19: 7,207,347 (GRCm39)	F126L	probably damaging	Het
Nbeal1	C	T	1: 60,277,813 (GRCm39)	S733F	probably damaging	Het
Olr1	T	C	6: 129,477,044 (GRCm39)	T74A	probably damaging	Het
Or52x1	A	G	7: 104,853,232 (GRCm39)	I106T	probably damaging	Het
Or5aq7	A	G	2: 86,938,527 (GRCm39)	F68S	possibly damaging	Het
Or5h17	A	C	16: 58,820,582 (GRCm39)	Y178S	probably damaging	Het
Pgam5	A	T	5: 110,413,691 (GRCm39)	V130D	probably damaging	Het
Pop4	A	G	7: 37,965,573 (GRCm39)	C115R	probably damaging	Het
Prpf18	A	T	2: 4,629,348 (GRCm39)		probably null	Het
Psg16	G	A	7: 16,829,031 (GRCm39)	R205H	possibly damaging	Het
Ptgr1	C	A	4: 58,981,879 (GRCm39)	A53S	probably benign	Het
Shank2	A	G	7: 143,965,008 (GRCm39)	D1451G	probably benign	Het
Sox8	G	A	17: 25,789,330 (GRCm39)	A56V	probably benign	Het
Ssr3	A	G	3: 65,295,175 (GRCm39)	S113P	probably damaging	Het
Stx16	T	C	2: 173,938,721 (GRCm39)	Y296H	possibly damaging	Het
Tfcp2	A	T	15: 100,426,370 (GRCm39)	N60K	probably benign	Het
Thada	T	C	17: 84,751,654 (GRCm39)	T441A	probably benign	Het
Trf	G	T	9: 103,105,074 (GRCm39)		probably benign	Het
Vamp2	T	A	11: 68,979,488 (GRCm39)		probably benign	Het
Vmn2r105	A	T	17: 20,448,280 (GRCm39)	D181E	probably benign	Het
Vmn2r12	A	T	5: 109,239,544 (GRCm39)	Y340N	probably damaging	Het
Wasf2	C	A	4: 132,923,170 (GRCm39)	D493E	unknown	Het
Wdfy4	T	C	14: 32,769,213 (GRCm39)	D2084G	possibly damaging	Het
Zfp229	T	A	17: 21,965,354 (GRCm39)	I528N	probably damaging	Het
Zfp703	T	A	8: 27,468,879 (GRCm39)	V181E	possibly damaging	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	82,926,085 (GRCm39)	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	82,926,353 (GRCm39)	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	82,926,322 (GRCm39)	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	82,926,761 (GRCm39)	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	82,919,938 (GRCm39)	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	82,923,016 (GRCm39)	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	82,919,890 (GRCm39)	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	82,923,117 (GRCm39)	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	82,921,090 (GRCm39)	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	82,920,971 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	82,926,128 (GRCm39)	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	82,926,600 (GRCm39)	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	82,920,360 (GRCm39)	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	82,926,479 (GRCm39)	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	82,926,388 (GRCm39)	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	82,926,235 (GRCm39)	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	82,920,676 (GRCm39)	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	82,920,869 (GRCm39)	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	82,921,168 (GRCm39)	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	82,926,511 (GRCm39)	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	82,919,756 (GRCm39)	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	82,919,955 (GRCm39)	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	82,926,260 (GRCm39)	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	82,921,207 (GRCm39)	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	82,921,341 (GRCm39)	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	82,919,851 (GRCm39)	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	82,926,113 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGCGTACCATTTGTGTGAGC -3'
(R):5'- CCATTATGTTACCCTGGTTCTTGGG -3'

Sequencing Primer
(F):5'- ACCATTTGTGTGAGCTTTTCCG -3'
(R):5'- CTTGGGAACTAGTCAGTCAAATG -3'

Posted On

2016-04-15