Incidental Mutation 'R4929:Zfp229'
ID381113
Institutional Source Beutler Lab
Gene Symbol Zfp229
Ensembl Gene ENSMUSG00000061544
Gene Namezinc finger protein 229
Synonyms
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4929 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21730795-21769342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21746373 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 528 (I528N)
Ref Sequence ENSEMBL: ENSMUSP00000138107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065871] [ENSMUST00000182603] [ENSMUST00000182827] [ENSMUST00000183192]
Predicted Effect probably damaging
Transcript: ENSMUST00000065871
AA Change: I528N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065379
Gene: ENSMUSG00000061544
AA Change: I528N

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
ZnF_C2H2 229 249 1.88e2 SMART
ZnF_C2H2 257 279 1.38e-3 SMART
ZnF_C2H2 285 307 3.63e-3 SMART
ZnF_C2H2 312 334 9.44e-2 SMART
ZnF_C2H2 340 362 3.58e-2 SMART
ZnF_C2H2 368 390 2.99e-4 SMART
ZnF_C2H2 395 417 2.36e-2 SMART
ZnF_C2H2 423 445 2.09e-3 SMART
ZnF_C2H2 451 473 1.18e-2 SMART
ZnF_C2H2 479 501 6.78e-3 SMART
ZnF_C2H2 507 529 1.28e-3 SMART
ZnF_C2H2 535 557 7.05e-1 SMART
ZnF_C2H2 562 584 8.02e-5 SMART
ZnF_C2H2 590 612 9.58e-3 SMART
ZnF_C2H2 618 640 7.78e-3 SMART
ZnF_C2H2 646 668 3.83e-2 SMART
ZnF_C2H2 674 696 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182603
AA Change: I528N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138107
Gene: ENSMUSG00000061544
AA Change: I528N

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Pfam:zf-C2H2_6 205 219 3.9e-1 PFAM
ZnF_C2H2 229 249 1.88e2 SMART
ZnF_C2H2 257 279 1.38e-3 SMART
ZnF_C2H2 285 307 3.63e-3 SMART
ZnF_C2H2 312 334 9.44e-2 SMART
ZnF_C2H2 340 362 3.58e-2 SMART
ZnF_C2H2 368 390 2.99e-4 SMART
ZnF_C2H2 395 417 2.36e-2 SMART
ZnF_C2H2 423 445 2.09e-3 SMART
ZnF_C2H2 451 473 1.18e-2 SMART
ZnF_C2H2 479 501 6.78e-3 SMART
ZnF_C2H2 507 529 1.28e-3 SMART
ZnF_C2H2 535 557 7.05e-1 SMART
ZnF_C2H2 562 584 8.02e-5 SMART
ZnF_C2H2 590 612 9.58e-3 SMART
ZnF_C2H2 618 640 7.78e-3 SMART
ZnF_C2H2 646 668 3.83e-2 SMART
ZnF_C2H2 674 696 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182827
SMART Domains Protein: ENSMUSP00000138478
Gene: ENSMUSG00000061544

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183192
SMART Domains Protein: ENSMUSP00000138265
Gene: ENSMUSG00000061544

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Zfp229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Zfp229 APN 17 21739502 missense possibly damaging 0.52
R0268:Zfp229 UTSW 17 21745841 missense probably benign
R0344:Zfp229 UTSW 17 21745841 missense probably benign
R0608:Zfp229 UTSW 17 21746634 missense probably damaging 1.00
R1672:Zfp229 UTSW 17 21745847 missense probably damaging 1.00
R2215:Zfp229 UTSW 17 21746277 missense possibly damaging 0.90
R2519:Zfp229 UTSW 17 21745587 missense possibly damaging 0.89
R2937:Zfp229 UTSW 17 21745503 missense probably damaging 1.00
R2965:Zfp229 UTSW 17 21746029 missense probably damaging 1.00
R3108:Zfp229 UTSW 17 21746816 missense probably damaging 1.00
R3768:Zfp229 UTSW 17 21745863 missense probably damaging 1.00
R3778:Zfp229 UTSW 17 21745202 missense probably benign 0.44
R3850:Zfp229 UTSW 17 21745862 missense probably damaging 1.00
R4273:Zfp229 UTSW 17 21746821 missense probably benign 0.02
R4731:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4732:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4733:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4818:Zfp229 UTSW 17 21743904 missense probably benign 0.33
R5512:Zfp229 UTSW 17 21745036 splice site probably null
R7124:Zfp229 UTSW 17 21742616 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAACATGCATGCTGGAAAAC -3'
(R):5'- TCCAGCATGAACTTTCTGATGT -3'

Sequencing Primer
(F):5'- GTGCTCATCTCTTAGAGCACATGAG -3'
(R):5'- CTGATGTGTTCTGAGAGACGAC -3'
Posted On2016-04-15