Incidental Mutation 'R4929:Sox8'
ID381114
Institutional Source Beutler Lab
Gene Symbol Sox8
Ensembl Gene ENSMUSG00000024176
Gene NameSRY (sex determining region Y)-box 8
Synonyms
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4929 (G1)
Quality Score97
Status Validated
Chromosome17
Chromosomal Location25565892-25570686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25570356 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 56 (A56V)
Ref Sequence ENSEMBL: ENSMUSP00000025003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]
Predicted Effect probably benign
Transcript: ENSMUST00000025003
AA Change: A56V

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: A56V

DomainStartEndE-ValueType
Pfam:Sox_N 18 86 3.8e-27 PFAM
HMG 98 168 3.86e-28 SMART
low complexity region 208 228 N/A INTRINSIC
low complexity region 303 321 N/A INTRINSIC
low complexity region 375 397 N/A INTRINSIC
low complexity region 407 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163493
Predicted Effect probably benign
Transcript: ENSMUST00000173447
AA Change: A56V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176
AA Change: A56V

DomainStartEndE-ValueType
Pfam:Sox_N 3 87 3.3e-25 PFAM
HMG 98 168 3.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174560
SMART Domains Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176

DomainStartEndE-ValueType
HMG 1 66 1.19e-19 SMART
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Sox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Sox8 APN 17 25567528 unclassified probably null
IGL01918:Sox8 APN 17 25570137 missense probably damaging 1.00
IGL02672:Sox8 APN 17 25568989 missense probably damaging 1.00
IGL03371:Sox8 APN 17 25567440 missense probably damaging 1.00
R1398:Sox8 UTSW 17 25567883 missense probably benign 0.01
R1673:Sox8 UTSW 17 25567482 missense possibly damaging 0.77
R1742:Sox8 UTSW 17 25567941 missense probably damaging 0.99
R4019:Sox8 UTSW 17 25570297 missense probably damaging 1.00
R4353:Sox8 UTSW 17 25567335 makesense probably null
R4466:Sox8 UTSW 17 25568905 missense probably benign 0.37
R4893:Sox8 UTSW 17 25568989 missense probably damaging 1.00
R5915:Sox8 UTSW 17 25567469 missense probably damaging 1.00
R6114:Sox8 UTSW 17 25567520 missense probably damaging 1.00
R6915:Sox8 UTSW 17 25567914 missense probably damaging 1.00
R7030:Sox8 UTSW 17 25570108 critical splice donor site probably null
R7232:Sox8 UTSW 17 25567540 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTTGCCTAGGGTCTTG -3'
(R):5'- CGATGCTGGACATGAGTGAG -3'

Sequencing Primer
(F):5'- CCTAGGGTCTTGCTGAGCTC -3'
(R):5'- TGGACATGAGTGAGGCCCG -3'
Posted On2016-04-15