Incidental Mutation 'R4929:Thada'
ID381115
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R4929 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84444226 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 441 (T441A)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably benign
Transcript: ENSMUST00000047524
AA Change: T441A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: T441A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Dym T A 18: 75,243,286 V583E probably damaging Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTTGGGACTTCAAATGGC -3'
(R):5'- ATCTGAACGGGGACTCATGC -3'

Sequencing Primer
(F):5'- ACATGGTTTCCAAGAGGTCAC -3'
(R):5'- GACTCATGCGTACCTAGGAGACTTC -3'
Posted On2016-04-15