Incidental Mutation 'R4277:A530032D15Rik'
ID381208
Institutional Source Beutler Lab
Gene Symbol A530032D15Rik
Ensembl Gene ENSMUSG00000089844
Gene NameRIKEN cDNA A530032D15Rik gene
SynonymsLOC381287
MMRRC Submission 041078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4277 (G1)
Quality Score29
Status Validated
Chromosome1
Chromosomal Location85083069-85109853 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 85088800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160792] [ENSMUST00000161724]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159114
Predicted Effect unknown
Transcript: ENSMUST00000160792
AA Change: S205N
SMART Domains Protein: ENSMUSP00000125122
Gene: ENSMUSG00000089844
AA Change: S205N

DomainStartEndE-ValueType
Pfam:Sp100 23 125 9.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161724
SMART Domains Protein: ENSMUSP00000123750
Gene: ENSMUSG00000089844

DomainStartEndE-ValueType
Pfam:Sp100 24 122 2.4e-40 PFAM
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b7 A G 6: 34,421,020 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh7 T A 1: 110,065,688 I291K probably benign Het
Cdhr3 T G 12: 33,060,233 S351R probably null Het
Dnah10 T C 5: 124,732,330 S221P probably benign Het
Dstyk G A 1: 132,455,413 probably null Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Folh1 A G 7: 86,762,915 probably null Het
Hemk1 A G 9: 107,328,529 Y260H possibly damaging Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Ldhc G A 7: 46,866,466 A62T probably benign Het
Ndufs1 C T 1: 63,170,097 V36I possibly damaging Het
Nsun4 C T 4: 116,034,282 G300D probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Ntn4 T C 10: 93,741,210 I580T possibly damaging Het
Olfr77 A G 9: 19,920,389 Y60C possibly damaging Het
Rasal2 A T 1: 157,157,126 I992N possibly damaging Het
Rasgrp4 T A 7: 29,152,594 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Spp2 T C 1: 88,411,151 F79L probably damaging Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Trpv3 A G 11: 73,296,438 T699A probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Other mutations in A530032D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:A530032D15Rik UTSW 1 85109351 missense probably damaging 0.99
PIT4131001:A530032D15Rik UTSW 1 85099620 missense probably benign 0.01
PIT4142001:A530032D15Rik UTSW 1 85099620 missense probably benign 0.01
R0602:A530032D15Rik UTSW 1 85099505 missense probably benign 0.00
R0831:A530032D15Rik UTSW 1 85099505 missense probably benign 0.00
R1147:A530032D15Rik UTSW 1 85099505 missense probably benign 0.00
R1852:A530032D15Rik UTSW 1 85085131 unclassified probably benign
R4385:A530032D15Rik UTSW 1 85109336 critical splice donor site probably null
R4391:A530032D15Rik UTSW 1 85085131 unclassified probably benign
R4691:A530032D15Rik UTSW 1 85088800 intron probably benign
R4863:A530032D15Rik UTSW 1 85088800 intron probably benign
R5173:A530032D15Rik UTSW 1 85100567 nonsense probably null
R5176:A530032D15Rik UTSW 1 85088800 intron probably benign
R6919:A530032D15Rik UTSW 1 85109346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCTGAGTCCTCACTGAG -3'
(R):5'- TTTCTCAGAACATACCCCACTGG -3'

Sequencing Primer
(F):5'- GAGTCTTTCAAATCCCGTCACAG -3'
(R):5'- CCCCACTGGTAAGCAATGGATG -3'
Posted On2016-04-15