Incidental Mutation 'R4945:Ndst3'
ID381287
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 042542-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R4945 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123552552 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 276 (I276N)
Ref Sequence ENSEMBL: ENSMUSP00000120623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000124803] [ENSMUST00000132112] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: I691N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: I691N

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124803
AA Change: I276N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122617
Gene: ENSMUSG00000027977
AA Change: I276N

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132112
AA Change: I276N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120623
Gene: ENSMUSG00000027977
AA Change: I276N

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132896
Predicted Effect probably benign
Transcript: ENSMUST00000137404
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: I691N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: I691N

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: I691N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: I691N

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199825
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,677,075 C170S possibly damaging Het
Adamts13 G A 2: 26,986,610 R512H probably damaging Het
Adgrl2 T A 3: 148,823,036 M1158L probably damaging Het
Adgrl3 C A 5: 81,512,048 H153Q probably damaging Het
Aldh1a2 C A 9: 71,215,916 Q24K probably benign Het
Atp1b1 A G 1: 164,438,298 V298A probably damaging Het
Casp8ap2 T A 4: 32,631,163 N74K possibly damaging Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cerk C G 15: 86,156,601 D186H probably benign Het
Cmtr2 T C 8: 110,221,433 F125S probably damaging Het
Col6a1 A G 10: 76,712,272 V650A unknown Het
Cuzd1 A G 7: 131,316,621 F196L probably damaging Het
Esm1 T G 13: 113,210,145 probably null Het
Fbn2 T A 18: 58,050,253 I1787F possibly damaging Het
Gm1110 T C 9: 26,920,595 M87V possibly damaging Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
Grk2 A G 19: 4,290,447 I302T probably damaging Het
Hoxb6 A G 11: 96,299,259 Y28C possibly damaging Het
Ift27 A G 15: 78,164,254 V110A probably damaging Het
Igfbp7 T C 5: 77,351,257 D267G probably benign Het
Ighv1-49 C A 12: 115,055,408 V56L possibly damaging Het
Ighv8-8 C T 12: 115,294,261 M53I probably benign Het
Kcnj3 T A 2: 55,437,578 N126K probably damaging Het
Kif12 C T 4: 63,168,493 probably null Het
Lrif1 A C 3: 106,735,753 I725L probably damaging Het
Lrrk2 T C 15: 91,804,920 V2265A probably benign Het
Med25 T C 7: 44,883,102 N438S possibly damaging Het
Mex3b A T 7: 82,870,174 T566S probably benign Het
Mkx T C 18: 7,000,657 N95S possibly damaging Het
Morc3 A T 16: 93,871,194 D820V probably damaging Het
Mroh4 G T 15: 74,612,008 N562K probably benign Het
Notch2 A G 3: 98,111,721 N733S probably benign Het
Olfr1025-ps1 T A 2: 85,918,573 I216N possibly damaging Het
Olfr1084 T C 2: 86,639,489 Y73C probably damaging Het
Olfr168 C A 16: 19,530,557 R121L probably benign Het
Olfr639 G A 7: 104,012,378 T108I possibly damaging Het
Olfr713 A T 7: 107,036,319 M55L probably benign Het
Olfr885 G T 9: 38,061,772 G151C probably damaging Het
Olfr907 A T 9: 38,499,289 I207F probably damaging Het
Olfr994 T C 2: 85,430,551 T93A probably benign Het
Patj A T 4: 98,495,064 N268Y probably damaging Het
Pbrm1 T A 14: 31,052,216 D446E probably damaging Het
Pcdhga11 A G 18: 37,758,032 T698A probably benign Het
Pde6a T C 18: 61,234,718 V266A probably damaging Het
Phax G T 18: 56,575,991 R209L probably damaging Het
Pld2 T A 11: 70,555,698 M20K probably damaging Het
Rabl3 T C 16: 37,541,858 S20P probably damaging Het
Rad51 T A 2: 119,127,148 V174E probably damaging Het
Rb1cc1 A G 1: 6,249,627 E1090G probably benign Het
Rfc3 T C 5: 151,642,985 E333G probably damaging Het
Rfx6 T G 10: 51,726,851 Y821* probably null Het
Riok3 A G 18: 12,128,915 D2G probably damaging Het
Rtn1 G T 12: 72,217,484 A183E probably damaging Het
Skint8 T C 4: 111,939,608 L303P probably damaging Het
Slc36a2 C A 11: 55,174,694 V162L probably benign Het
Sorcs3 T C 19: 48,764,148 V794A possibly damaging Het
Sspo A G 6: 48,467,087 probably null Het
Tbk1 T C 10: 121,551,269 N707S probably damaging Het
Tchhl1 A T 3: 93,471,576 H529L probably benign Het
Tgfbr2 A T 9: 116,131,565 H106Q probably benign Het
Trim8 A G 19: 46,502,775 E111G probably benign Het
Tshz2 A G 2: 169,883,874 Y130C probably damaging Het
Txndc15 T A 13: 55,718,165 D147E probably benign Het
Vmn1r172 T A 7: 23,660,320 L210H possibly damaging Het
Vmn1r55 A G 7: 5,147,106 V106A probably damaging Het
Vmn2r49 T A 7: 9,986,287 K426* probably null Het
Wnk2 C T 13: 49,057,246 R206Q probably damaging Het
Zfp473 T C 7: 44,734,564 N115S probably benign Het
Zfp536 G T 7: 37,569,736 A85D probably damaging Het
Zfp853 C A 5: 143,288,829 Q345H unknown Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCTTTTATCCAAATCTGAGAGGG -3'
(R):5'- TCACCAGCATATAAACGTAAGGG -3'

Sequencing Primer
(F):5'- ATGGAAGCGTCTGAGACTCATTCC -3'
(R):5'- GGCTTGTTTTGAAAAAGATGCTCC -3'
Posted On2016-04-27