Incidental Mutation 'R4953:Cntn4'
ID381378
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 042550-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R4953 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106525418 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 379 (A379T)
Ref Sequence ENSEMBL: ENSMUSP00000078385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably benign
Transcript: ENSMUST00000079416
AA Change: A379T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293
AA Change: A379T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089208
AA Change: A379T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: A379T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113258
AA Change: A379T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293
AA Change: A379T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113260
AA Change: A379T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293
AA Change: A379T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113261
AA Change: A379T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293
AA Change: A379T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113264
AA Change: A379T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: A379T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgre1 G A 17: 57,441,321 G507E probably damaging Het
Agpat5 G A 8: 18,868,955 V118I probably benign Het
Aif1 T C 17: 35,171,098 probably null Het
Akr1c6 A T 13: 4,438,609 probably null Het
Akt2 T A 7: 27,638,172 probably null Het
Ankrd35 T A 3: 96,683,673 L425Q possibly damaging Het
Arhgap40 A G 2: 158,543,406 T520A possibly damaging Het
Arhgef28 T A 13: 97,929,554 D1597V possibly damaging Het
Aspm A G 1: 139,471,734 D1079G probably benign Het
Atp1a2 A T 1: 172,291,442 probably benign Het
Cage1 C A 13: 38,023,430 E252D possibly damaging Het
Ccdc185 A G 1: 182,749,017 S36P possibly damaging Het
Cd300a T C 11: 114,893,421 V85A probably damaging Het
Cd38 A C 5: 43,907,545 D235A possibly damaging Het
Cdcp1 T C 9: 123,180,023 K530R probably benign Het
Ceacam20 T A 7: 19,971,726 L214Q probably damaging Het
Col4a2 A T 8: 11,429,505 E796V probably benign Het
Copa A G 1: 172,082,886 probably benign Het
Cpa5 A G 6: 30,631,364 T426A possibly damaging Het
Csmd1 A G 8: 16,199,917 F1016L probably damaging Het
Cyb5r3 A T 15: 83,158,621 L290* probably null Het
Ddx42 A G 11: 106,242,940 T581A probably damaging Het
Deaf1 C T 7: 141,322,468 G221S probably damaging Het
Dnah6 A G 6: 73,188,383 S580P probably benign Het
Dock1 A G 7: 135,152,288 E1598G probably benign Het
Drg2 T C 11: 60,459,436 probably benign Het
Eif3f C A 7: 108,934,640 probably benign Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Gas7 C T 11: 67,660,050 T126M possibly damaging Het
Gckr T G 5: 31,308,264 F408C probably damaging Het
Gm17472 A G 6: 42,981,070 D91G probably damaging Het
Gm5117 G A 8: 31,738,580 noncoding transcript Het
Gsto1 T A 19: 47,855,320 I47N probably damaging Het
Hck C T 2: 153,134,677 P244S probably damaging Het
Hif3a T C 7: 17,050,565 T250A probably damaging Het
Hmcn1 A T 1: 150,876,360 probably benign Het
Impa1 G A 3: 10,315,280 S247F probably damaging Het
Ints14 G C 9: 64,982,058 R397P probably damaging Het
Iqgap1 T C 7: 80,723,776 probably null Het
Krt2 T C 15: 101,813,942 K436R probably damaging Het
Lama3 G A 18: 12,448,305 C607Y probably damaging Het
Loxl4 G T 19: 42,610,694 probably benign Het
Lrrc8d C T 5: 105,813,368 T548M probably damaging Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mapk8ip2 C T 15: 89,457,228 P214L probably benign Het
Mast1 G A 8: 84,918,728 T696I probably damaging Het
Muc15 C T 2: 110,731,272 P18S probably damaging Het
Mybl2 T C 2: 163,080,796 S205P probably damaging Het
Mylk T C 16: 34,988,961 S1763P probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nfib A G 4: 82,353,571 M252T probably benign Het
Nid2 C A 14: 19,778,078 Y261* probably null Het
Nmd3 C T 3: 69,731,637 R187C possibly damaging Het
Nomo1 G T 7: 46,050,731 probably benign Het
Npy4r A G 14: 34,146,480 F284L probably damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1480 T A 19: 13,529,814 L91Q probably null Het
Olfr996 T A 2: 85,579,725 L162* probably null Het
Pcdhb12 T A 18: 37,436,156 D118E probably damaging Het
Pdcd11 C T 19: 47,127,965 T1518I probably benign Het
Pde6a T A 18: 61,231,362 C163* probably null Het
Pign A T 1: 105,644,502 W314R probably benign Het
Pip5k1b T A 19: 24,390,435 H76L probably damaging Het
Plcz1 T C 6: 140,028,551 N55S possibly damaging Het
Pou5f1 A T 17: 35,510,541 H350L possibly damaging Het
Rchy1 A T 5: 91,962,628 probably null Het
Ric8b A G 10: 84,958,082 T270A possibly damaging Het
Rprml A G 11: 103,649,818 E13G probably benign Het
Secisbp2 T A 13: 51,682,027 I719N probably damaging Het
Sergef C T 7: 46,633,835 R148H probably benign Het
Serpina6 T A 12: 103,651,962 probably null Het
Sirpb1b C A 3: 15,548,827 W65L probably damaging Het
Slc32a1 A T 2: 158,614,057 I211F possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Smarce1 A G 11: 99,215,151 V226A probably benign Het
Spata31d1b A T 13: 59,716,283 E415V probably damaging Het
Speg G A 1: 75,423,864 R2556H possibly damaging Het
Suclg2 A C 6: 95,566,436 V338G probably damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tex14 G T 11: 87,536,901 probably null Het
Trim36 T A 18: 46,196,178 D53V possibly damaging Het
Tsga10ip T A 19: 5,394,340 Y21F possibly damaging Het
Ttn C T 2: 76,789,945 V15849M probably damaging Het
Ube3b T C 5: 114,401,410 S421P probably benign Het
Unc5a A T 13: 54,999,870 M498L probably benign Het
Vipr2 A G 12: 116,144,256 I420M probably benign Het
Vmn1r179 T A 7: 23,929,090 H235Q probably damaging Het
Vps35 T A 8: 85,281,846 I267F probably damaging Het
Wdr26 G A 1: 181,197,651 R279W probably damaging Het
Xpo6 C A 7: 126,169,271 R88L probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp105 T A 9: 122,929,815 S184T probably benign Het
Zfp574 G A 7: 25,080,963 R470H probably damaging Het
Zswim9 T A 7: 13,269,558 H122L probably damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATTTGCCATCTGACCTGG -3'
(R):5'- CCATTGCTTGCAGGCTATATG -3'

Sequencing Primer
(F):5'- ACTTGACAAATAAGCAGATCGTG -3'
(R):5'- CCATTGCTTGCAGGCTATATGACTTG -3'
Posted On2016-04-27