Incidental Mutation 'R4954:Eps15'
ID381468
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 042551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4954 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 109370678 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030281] [ENSMUST00000030281] [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000175776] [ENSMUST00000176251]
Predicted Effect probably null
Transcript: ENSMUST00000030281
SMART Domains Protein: ENSMUSP00000030281
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
SCOP:d1bg1a1 37 178 8e-8 SMART
low complexity region 191 202 N/A INTRINSIC
internal_repeat_1 308 341 5.7e-7 PROSPERO
low complexity region 348 371 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
internal_repeat_1 485 517 5.7e-7 PROSPERO
UIM 538 557 3.32e0 SMART
UIM 564 583 1.55e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000030281
SMART Domains Protein: ENSMUSP00000030281
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
SCOP:d1bg1a1 37 178 8e-8 SMART
low complexity region 191 202 N/A INTRINSIC
internal_repeat_1 308 341 5.7e-7 PROSPERO
low complexity region 348 371 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
internal_repeat_1 485 517 5.7e-7 PROSPERO
UIM 538 557 3.32e0 SMART
UIM 564 583 1.55e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102729
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126015
Predicted Effect probably null
Transcript: ENSMUST00000132165
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132165
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175776
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175776
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect silent
Transcript: ENSMUST00000176251
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177140
Predicted Effect probably null
Transcript: ENSMUST00000177192
Predicted Effect probably null
Transcript: ENSMUST00000177192
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,911,434 H668Y probably benign Het
AI464131 G A 4: 41,498,241 A463V possibly damaging Het
Alk C T 17: 71,902,692 W919* probably null Het
Aoc3 G A 11: 101,332,099 G387D probably damaging Het
Arhgap26 T A 18: 39,243,641 C441S probably benign Het
Arhgap28 C A 17: 67,869,013 E100* probably null Het
Ate1 C T 7: 130,509,018 G186D probably benign Het
Birc6 T A 17: 74,612,031 L1948H probably damaging Het
Bmp2k C T 5: 97,086,764 probably benign Het
Ccin A T 4: 43,985,077 I495F probably benign Het
Cir1 T A 2: 73,310,504 E40D probably benign Het
Cyp3a57 A T 5: 145,370,955 probably null Het
Dennd1b A G 1: 139,053,386 T113A probably damaging Het
Dnah2 G A 11: 69,539,496 P79S possibly damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Enpep A T 3: 129,284,180 I596N probably damaging Het
Ext1 T C 15: 53,344,492 D291G probably damaging Het
Gm12883 T C 4: 121,395,001 noncoding transcript Het
Gm7257 A T 9: 36,432,860 K46N probably benign Het
Gm9921 A G 12: 45,437,600 noncoding transcript Het
H2-T22 C A 17: 36,041,959 W85C probably damaging Het
Heatr1 G A 13: 12,407,516 probably null Het
Hspa4l T A 3: 40,785,400 probably null Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Kpna1 T C 16: 36,033,326 V442A probably damaging Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Musk C T 4: 58,344,222 T285I probably damaging Het
Nbea T G 3: 56,035,958 Q632P probably damaging Het
Ncoa3 T C 2: 166,065,786 V1105A probably benign Het
Neb T C 2: 52,177,518 probably null Het
Nlrp4e A T 7: 23,361,893 K970* probably null Het
Olfr309 T C 7: 86,306,601 I171V probably benign Het
Olfr47 A G 6: 43,236,384 M259V probably benign Het
Olfr628 A G 7: 103,732,207 I94V probably damaging Het
Oog2 A T 4: 144,190,732 probably benign Het
Otos T C 1: 92,644,445 Y53C probably damaging Het
Oxct2a A T 4: 123,322,459 C376* probably null Het
Phf14 C A 6: 11,987,620 Q633K probably benign Het
Pkdrej T A 15: 85,816,401 N1778I probably damaging Het
Psmc3 C T 2: 91,055,629 probably benign Het
Rbm33 A T 5: 28,339,276 I177F probably damaging Het
Rps6ka2 A G 17: 7,271,604 D307G probably benign Het
Rps6ka2 G A 17: 7,299,286 V648I probably benign Het
Scn11a C T 9: 119,758,659 V1340M possibly damaging Het
Sema7a T C 9: 57,956,380 W279R probably damaging Het
Slc2a10 A T 2: 165,514,755 I112F probably damaging Het
Stk4 C A 2: 164,151,681 S77R possibly damaging Het
Stk4 T A 2: 164,151,682 W78R probably damaging Het
Syf2 T A 4: 134,934,972 L99* probably null Het
Tas2r104 A T 6: 131,685,005 I247K probably damaging Het
Usp15 G T 10: 123,131,398 R368S probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r2 T A 3: 64,140,484 L20F probably benign Het
Wdr60 T C 12: 116,256,025 D99G probably damaging Het
Zcchc4 A T 5: 52,819,217 H451L probably damaging Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7461:Eps15 UTSW 4 109329725 missense probably damaging 1.00
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGGCTCATAAGGAATGCCTC -3'
(R):5'- GGACAACTTCATCCTGAGACAC -3'

Sequencing Primer
(F):5'- GCTCATAAGGAATGCCTCAAAGTGTC -3'
(R):5'- ACTATAAATCATCTACTCCTCTCCAG -3'
Posted On2016-04-27