Incidental Mutation 'R0400:Zzef1'
ID38149
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72895242 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 2080 (R2080K)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: R2080K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: R2080K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: R2080K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: R2080K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: R2080K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.568 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 synonymous probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- gcattaccaagtctggctTTAGCAGTAG -3'
(R):5'- AGCAACATGGTACTCAGAAGATTGCAC -3'

Sequencing Primer
(F):5'- caagtctggctTTAGCAGTAGAATAG -3'
(R):5'- AAGAAACACTGCCTGCCTCT -3'
Posted On2013-05-23