Incidental Mutation 'R4956:Tchp'
ID381568
Institutional Source Beutler Lab
Gene Symbol Tchp
Ensembl Gene ENSMUSG00000002486
Gene Nametrichoplein, keratin filament binding
SynonymsA930031F18Rik
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4956 (G1)
Quality Score209
Status Validated
Chromosome5
Chromosomal Location114707760-114722327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114719620 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 391 (E391D)
Ref Sequence ENSEMBL: ENSMUSP00000092009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094441]
Predicted Effect probably damaging
Transcript: ENSMUST00000094441
AA Change: E391D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092009
Gene: ENSMUSG00000002486
AA Change: E391D

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
coiled coil region 69 140 N/A INTRINSIC
Pfam:TPH 145 485 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112199
SMART Domains Protein: ENSMUSP00000107818
Gene: ENSMUSG00000002486

DomainStartEndE-ValueType
Pfam:Trichoplein 1 233 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128625
Predicted Effect unknown
Transcript: ENSMUST00000131679
AA Change: E191D
SMART Domains Protein: ENSMUSP00000119890
Gene: ENSMUSG00000002486
AA Change: E191D

DomainStartEndE-ValueType
low complexity region 15 39 N/A INTRINSIC
Pfam:TPH 50 215 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202276
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Tchp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Tchp APN 5 114708733 missense probably benign 0.00
R0266:Tchp UTSW 5 114709333 missense possibly damaging 0.87
R0454:Tchp UTSW 5 114720182 missense probably benign 0.02
R0709:Tchp UTSW 5 114717453 missense probably damaging 1.00
R0725:Tchp UTSW 5 114719621 missense probably benign 0.04
R2680:Tchp UTSW 5 114709519 critical splice donor site probably null
R4604:Tchp UTSW 5 114719573 splice site probably null
R6662:Tchp UTSW 5 114720015 intron probably null
R6945:Tchp UTSW 5 114709350 missense possibly damaging 0.76
R7002:Tchp UTSW 5 114708796 missense probably benign 0.39
R7288:Tchp UTSW 5 114715569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGAAAGAGCAGTGGTCTG -3'
(R):5'- AGCAAGCAATGGACTGGACTC -3'

Sequencing Primer
(F):5'- AGTGGTCTGCACTGGGC -3'
(R):5'- ATGGACTGGACTCAAGGACCTC -3'
Posted On2016-04-27