Incidental Mutation 'R4956:Atf7ip'
ID381576
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Nameactivating transcription factor 7 interacting protein
SynonymsMcaf1, 2610204M12Rik, AM, ATFa-associated Modulator
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136506167-136610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136606810 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1280 (R1280C)
Ref Sequence ENSEMBL: ENSMUSP00000032335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335]
Predicted Effect probably damaging
Transcript: ENSMUST00000032335
AA Change: R1280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: R1280C

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185332
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136560681 missense probably benign 0.00
IGL01483:Atf7ip APN 6 136587459 missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136606720 missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136593118 missense probably benign 0.01
IGL02547:Atf7ip APN 6 136603276 splice site probably benign
IGL02869:Atf7ip APN 6 136606579 missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136560688 missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136606727 missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136605382 missense possibly damaging 0.79
R0024:Atf7ip UTSW 6 136599820 splice site probably benign
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136560989 missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136561163 missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136560012 missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136609192 unclassified probably benign
R0526:Atf7ip UTSW 6 136559805 missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136606867 missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136603324 missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136609219 unclassified probably benign
R1822:Atf7ip UTSW 6 136587260 missense probably benign 0.11
R1873:Atf7ip UTSW 6 136559888 missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136560780 missense probably benign 0.41
R2059:Atf7ip UTSW 6 136609348 unclassified probably benign
R2134:Atf7ip UTSW 6 136605487 missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136566651 missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136575324 unclassified probably benign
R3755:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3756:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3890:Atf7ip UTSW 6 136587045 missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136587501 missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136563749 splice site probably null
R4588:Atf7ip UTSW 6 136599694 missense probably benign
R4618:Atf7ip UTSW 6 136565106 missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136561194 missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136596491 missense probably benign 0.06
R4922:Atf7ip UTSW 6 136560041 missense possibly damaging 0.91
R4957:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136582428 missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136561388 missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136560234 missense probably benign
R5279:Atf7ip UTSW 6 136603379 nonsense probably null
R5445:Atf7ip UTSW 6 136587257 missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136606814 missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136566787 critical splice donor site probably null
R5891:Atf7ip UTSW 6 136559977 missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136571502 missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136559819 missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136582391 missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136561040 missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136559757 splice site probably null
R7075:Atf7ip UTSW 6 136596515 critical splice donor site probably null
R7308:Atf7ip UTSW 6 136565089 missense probably benign 0.01
R7365:Atf7ip UTSW 6 136560710 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAATGGCATTGTTCTGTCG -3'
(R):5'- TCACATGTCCGGGAGATCTTG -3'

Sequencing Primer
(F):5'- TCCTGGAAGTGGACCGAAGC -3'
(R):5'- TGTCCGGGAGATCTTGCACAAG -3'
Posted On2016-04-27