Incidental Mutation 'R4956:Ppp1r37'
ID381577
Institutional Source Beutler Lab
Gene Symbol Ppp1r37
Ensembl Gene ENSMUSG00000051403
Gene Nameprotein phosphatase 1, regulatory subunit 37
SynonymsLrrc68
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19530800-19563076 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19532711 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 417 (L417*)
Ref Sequence ENSEMBL: ENSMUSP00000060233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058444]
Predicted Effect probably null
Transcript: ENSMUST00000058444
AA Change: L417*
SMART Domains Protein: ENSMUSP00000060233
Gene: ENSMUSG00000051403
AA Change: L417*

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
Blast:LRR 139 166 1e-9 BLAST
LRR 224 251 1.77e2 SMART
LRR 252 280 3.52e-1 SMART
LRR 281 308 8.27e-7 SMART
LRR 310 337 3.05e1 SMART
LRR 338 365 1.4e-4 SMART
LRR 366 393 1.56e-2 SMART
LRR 394 421 2.36e-2 SMART
low complexity region 504 540 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 596 628 N/A INTRINSIC
low complexity region 660 679 N/A INTRINSIC
low complexity region 696 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209190
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Ppp1r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0313:Ppp1r37 UTSW 7 19533998 missense probably damaging 1.00
R0718:Ppp1r37 UTSW 7 19532254 missense probably benign
R0883:Ppp1r37 UTSW 7 19532177 missense probably benign 0.01
R1606:Ppp1r37 UTSW 7 19534999 missense probably damaging 0.97
R2220:Ppp1r37 UTSW 7 19532446 missense probably null 0.43
R2256:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2257:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2325:Ppp1r37 UTSW 7 19532684 missense probably damaging 1.00
R2510:Ppp1r37 UTSW 7 19532432 missense possibly damaging 0.79
R3401:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R3402:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R4006:Ppp1r37 UTSW 7 19535069 missense probably damaging 1.00
R4750:Ppp1r37 UTSW 7 19531520 missense probably benign
R5156:Ppp1r37 UTSW 7 19561975 unclassified probably benign
R5582:Ppp1r37 UTSW 7 19532294 missense probably damaging 1.00
R5659:Ppp1r37 UTSW 7 19535523 missense probably damaging 1.00
R5918:Ppp1r37 UTSW 7 19532111 missense probably benign 0.02
R6172:Ppp1r37 UTSW 7 19532404 missense possibly damaging 0.93
R6659:Ppp1r37 UTSW 7 19532123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTTCACCTGTGGGAC -3'
(R):5'- CGAAACCTCAAGAATGGGCTC -3'

Sequencing Primer
(F):5'- TTCACCTGTGGGACCCAGC -3'
(R):5'- TCATCAGCAACCGCAGTGTG -3'
Posted On2016-04-27