Incidental Mutation 'R4956:Scaper'
ID381585
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene NameS phase cyclin A-associated protein in the ER
SynonymsD530014O03Rik, Zfp291
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.552) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location55549879-55938119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55838142 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 614 (K614R)
Ref Sequence ENSEMBL: ENSMUSP00000149750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
Predicted Effect probably damaging
Transcript: ENSMUST00000037408
AA Change: K614R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: K614R

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214747
AA Change: K608R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect probably damaging
Transcript: ENSMUST00000217647
AA Change: K614R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55859859 missense probably damaging 0.99
IGL00912:Scaper APN 9 55685955 missense probably damaging 1.00
IGL01469:Scaper APN 9 55859767 missense probably damaging 1.00
IGL01626:Scaper APN 9 55912051 missense possibly damaging 0.61
IGL01779:Scaper APN 9 55892240 missense probably benign 0.20
IGL02011:Scaper APN 9 55580322 missense probably damaging 1.00
IGL02997:Scaper APN 9 55815499 missense probably damaging 1.00
IGL03107:Scaper APN 9 55858402 splice site probably benign
IGL03167:Scaper APN 9 55859824 missense probably damaging 1.00
IGL03293:Scaper APN 9 55874823 missense probably benign
IGL03340:Scaper APN 9 55602832 missense possibly damaging 0.88
IGL03368:Scaper APN 9 55656027 missense possibly damaging 0.53
R0111:Scaper UTSW 9 55602790 missense probably benign 0.01
R0510:Scaper UTSW 9 55758062 splice site probably benign
R0531:Scaper UTSW 9 55609874 missense possibly damaging 0.91
R0558:Scaper UTSW 9 55685923 missense probably benign 0.08
R0605:Scaper UTSW 9 55815518 splice site probably benign
R0646:Scaper UTSW 9 55758056 missense probably damaging 1.00
R0837:Scaper UTSW 9 55859042 nonsense probably null
R1440:Scaper UTSW 9 55602918 nonsense probably null
R1548:Scaper UTSW 9 55816670 missense probably damaging 1.00
R1777:Scaper UTSW 9 55864546 missense probably benign 0.33
R1822:Scaper UTSW 9 55859900 missense probably damaging 0.99
R1834:Scaper UTSW 9 55816734 missense possibly damaging 0.90
R1870:Scaper UTSW 9 55685938 missense probably damaging 1.00
R2102:Scaper UTSW 9 55912050 missense probably benign 0.43
R2168:Scaper UTSW 9 55743639 missense probably damaging 1.00
R2174:Scaper UTSW 9 55859037 missense probably null 0.01
R3690:Scaper UTSW 9 55883921 missense probably benign 0.00
R4392:Scaper UTSW 9 55858115 missense probably damaging 0.99
R4418:Scaper UTSW 9 55838180 missense probably damaging 1.00
R4606:Scaper UTSW 9 55655903 critical splice donor site probably null
R4643:Scaper UTSW 9 55838179 missense probably damaging 0.99
R4665:Scaper UTSW 9 55912055 missense probably damaging 1.00
R4739:Scaper UTSW 9 55743648 missense probably damaging 1.00
R4921:Scaper UTSW 9 55892235 missense probably benign 0.02
R4934:Scaper UTSW 9 55809175 missense probably damaging 1.00
R5055:Scaper UTSW 9 55859719 intron probably null
R5107:Scaper UTSW 9 55580332 missense probably damaging 1.00
R5155:Scaper UTSW 9 55556086 missense probably null 1.00
R5265:Scaper UTSW 9 55864546 missense probably benign
R5408:Scaper UTSW 9 55586224 missense probably damaging 0.99
R5623:Scaper UTSW 9 55864507 missense probably benign 0.02
R5665:Scaper UTSW 9 55807632 missense probably damaging 1.00
R5748:Scaper UTSW 9 55859076 critical splice acceptor site probably null
R5771:Scaper UTSW 9 55816791 missense probably damaging 1.00
R6534:Scaper UTSW 9 55883976 missense probably benign 0.00
R6557:Scaper UTSW 9 55550850 missense probably benign 0.02
R6651:Scaper UTSW 9 55858504 missense probably benign 0.05
R6796:Scaper UTSW 9 55864427 missense probably benign 0.00
R6962:Scaper UTSW 9 55859771 missense probably benign 0.01
R7145:Scaper UTSW 9 55912111 missense unknown
R7199:Scaper UTSW 9 55838176 nonsense probably null
R7356:Scaper UTSW 9 55892211 missense unknown
X0012:Scaper UTSW 9 55655930 missense probably damaging 0.98
X0052:Scaper UTSW 9 55816664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGCAGAAATCTTTGGAATAGAC -3'
(R):5'- ACCCCTTAGTCCTCTGATGAATTAC -3'

Sequencing Primer
(F):5'- GTGCAGCTTATCCTGTCAAGTAGATC -3'
(R):5'- ACTAGATCAACGACGTAGG -3'
Posted On2016-04-27