Incidental Mutation 'R4957:Itga11'
ID381655
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4957 (G1)
Quality Score90
Status Validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62767648 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 821 (T821S)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: T821S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: T821S

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTGTGAACAGTAGGCCGG -3'
(R):5'- ATTGACGAGCCAGTGAGAGC -3'

Sequencing Primer
(F):5'- ATGAGCTCTTTGCAGGCC -3'
(R):5'- ACACAGCTCTGCCAGTGTC -3'
Posted On2016-04-27