Incidental Mutation 'R0401:Crb1'
ID38169
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission 038606-MU
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R0401 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 139198791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825]
Predicted Effect probably benign
Transcript: ENSMUST00000059825
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199479
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,070,306 H1752L possibly damaging Het
8030462N17Rik C A 18: 77,673,962 S218I probably damaging Het
A530099J19Rik A T 13: 19,729,494 noncoding transcript Het
Abcc5 T C 16: 20,376,558 K730E probably benign Het
Ahnak A G 19: 9,015,116 D4588G probably benign Het
AI467606 G A 7: 127,092,436 R61H probably damaging Het
Apoa4 T A 9: 46,243,058 V319E probably damaging Het
Atad5 T A 11: 80,120,699 D1297E probably benign Het
BC005624 G A 2: 30,980,009 T62I probably benign Het
Bcl6 T C 16: 23,972,594 K337E probably damaging Het
Cad T A 5: 31,073,986 probably benign Het
Ccdc73 T C 2: 104,991,289 S528P probably benign Het
Ccng2 T G 5: 93,273,413 C261G possibly damaging Het
Cdh11 A T 8: 102,674,006 I110N probably damaging Het
Cgnl1 A G 9: 71,705,239 V767A probably damaging Het
Cit A G 5: 115,985,479 T1460A probably benign Het
Clec4b2 C T 6: 123,181,300 Q42* probably null Het
Clip1 A G 5: 123,653,789 V106A probably damaging Het
Cts6 T C 13: 61,198,339 probably benign Het
Cul9 T C 17: 46,541,704 E244G probably damaging Het
Ddx55 A T 5: 124,567,951 I480F probably damaging Het
Dixdc1 A G 9: 50,693,674 S17P possibly damaging Het
Drosha T A 15: 12,926,031 Y1235* probably null Het
Dsg2 G T 18: 20,592,508 probably benign Het
E2f5 T C 3: 14,579,025 probably null Het
Epc2 A G 2: 49,528,974 T265A probably damaging Het
Etaa1 T G 11: 17,947,514 D201A probably damaging Het
Fancd2 T C 6: 113,548,343 I260T possibly damaging Het
Fhdc1 G A 3: 84,444,624 A1098V probably benign Het
Gm17689 G T 9: 36,582,628 A3E unknown Het
Gm7030 C T 17: 36,128,705 V128M probably damaging Het
Gpd2 G A 2: 57,340,093 V286I possibly damaging Het
Herc2 A C 7: 56,157,732 E2523A probably damaging Het
Jmjd1c G A 10: 67,220,382 R527H probably damaging Het
Kif12 G A 4: 63,169,525 probably benign Het
Lrp2 A T 2: 69,479,148 N2802K probably damaging Het
Mab21l2 C G 3: 86,546,989 G235R probably benign Het
Mapk8 T C 14: 33,382,208 E417G probably benign Het
Mapk8ip3 G A 17: 24,909,171 probably benign Het
Mettl1 A G 10: 127,045,077 T203A probably benign Het
Mettl9 T C 7: 121,076,313 V312A probably damaging Het
Mex3d A G 10: 80,386,894 V176A probably benign Het
Mmp3 T C 9: 7,449,790 S225P probably damaging Het
Mrvi1 G A 7: 110,876,897 P757S probably benign Het
Neb G A 2: 52,188,677 probably benign Het
Ninj2 C T 6: 120,198,051 A51V possibly damaging Het
Nle1 A G 11: 82,905,379 probably benign Het
Nol9 T C 4: 152,052,605 Y532H probably benign Het
Nr2c1 T A 10: 94,171,158 V286E probably benign Het
Olfr1183 T G 2: 88,461,925 L195R probably damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr308 T C 7: 86,321,292 Y220C probably benign Het
Olfr481 T A 7: 108,080,872 I26N possibly damaging Het
Olfr670 T A 7: 104,959,943 H263L probably damaging Het
Olfr816 A G 10: 129,911,916 Y121H probably benign Het
Olfr827 A G 10: 130,210,620 L170P probably damaging Het
Ovch2 A T 7: 107,801,136 V15D probably damaging Het
Pclo T G 5: 14,681,734 S3417A unknown Het
Pet2 C A X: 89,405,209 R438L probably benign Het
Pex1 T A 5: 3,633,759 M1085K probably damaging Het
Plscr2 T C 9: 92,282,135 S6P probably benign Het
Pogz C T 3: 94,877,025 P722S possibly damaging Het
Pom121l2 A T 13: 21,982,225 D222V probably benign Het
Prpf40a T C 2: 53,159,313 Y179C probably damaging Het
R3hdm2 A G 10: 127,458,173 I179V possibly damaging Het
Ranbp9 A C 13: 43,422,658 V355G probably damaging Het
Rims2 T C 15: 39,509,632 probably benign Het
Ryr2 A T 13: 11,705,684 S2693T probably benign Het
Sbno1 G A 5: 124,410,285 T111I probably damaging Het
Sdk1 A C 5: 142,046,161 N997T possibly damaging Het
Setx G T 2: 29,166,289 E39* probably null Het
Skint7 T A 4: 111,980,362 N112K probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 A T 2: 62,190,848 D80V probably benign Het
Susd2 C A 10: 75,638,603 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcf3 G T 10: 80,421,158 S77R probably damaging Het
Tdpoz3 T C 3: 93,826,365 Y116H probably benign Het
Tex26 C A 5: 149,460,858 D164E probably benign Het
Thoc5 G A 11: 4,902,213 probably benign Het
Tiparp A G 3: 65,531,436 R58G probably benign Het
Trim66 A T 7: 109,475,264 C597S probably damaging Het
Ugt2a3 T A 5: 87,336,490 Q225L probably benign Het
Vmn1r25 T A 6: 57,978,711 I198L probably benign Het
Vmn2r106 A T 17: 20,279,019 V210D possibly damaging Het
Vmn2r124 T C 17: 18,064,145 F483L probably damaging Het
Vmn2r78 A G 7: 86,921,311 K346E probably benign Het
Zfhx4 T A 3: 5,401,161 S2126R possibly damaging Het
Zfp608 C T 18: 54,898,994 G625R probably benign Het
Zkscan5 A G 5: 145,212,575 D234G probably damaging Het
Zscan10 T A 17: 23,605,915 V115E probably damaging Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCCTAGATGAGCCTTTCCAGTGCC -3'
(R):5'- GCTTCAACACCATGTGCTTGAACG -3'

Sequencing Primer
(F):5'- GCGGCATCCTGATCCAC -3'
(R):5'- CGTCACAGTCCAATAAGTTTAGG -3'
Posted On2013-05-23