Mutagenetix > Incidental Mutation

Incidental Mutation 'R4961:Otof'

381752

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

042558-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R4961 (G1)

Quality Score

104

Status

Validated

Chromosome

Chromosomal Location

30524406-30619276 bp(-) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 30540837 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074171

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114747

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.3%
20x: 88.3%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	T	C	5: 139,349,855 (GRCm39)	K65E	probably damaging	Het
Acp5	C	A	9: 22,041,233 (GRCm39)	A65S	probably benign	Het
Adad2	G	A	8: 120,342,397 (GRCm39)	R345H	probably damaging	Het
Adamts7	G	T	9: 90,067,793 (GRCm39)	G428W	probably damaging	Het
Amy1	A	G	3: 113,355,498 (GRCm39)	S326P	probably damaging	Het
Ankrd44	C	T	1: 54,703,071 (GRCm39)	D482N	probably damaging	Het
Anks6	C	T	4: 47,030,795 (GRCm39)	G601S	probably damaging	Het
Ano8	G	C	8: 71,935,640 (GRCm39)	P326R	probably damaging	Het
Arhgef26	A	G	3: 62,367,046 (GRCm39)	E793G	probably damaging	Het
Cd9	A	T	6: 125,440,703 (GRCm39)	V96E	probably damaging	Het
Cdh9	A	G	15: 16,850,914 (GRCm39)	N561S	probably benign	Het
Col16a1	G	A	4: 129,948,272 (GRCm39)		probably null	Het
Cpne7	G	A	8: 123,860,498 (GRCm39)	G484R	probably damaging	Het
Dcun1d4	A	T	5: 73,701,463 (GRCm39)	K194*	probably null	Het
Dock3	A	G	9: 106,818,515 (GRCm39)	V1193A	probably damaging	Het
Dst	A	G	1: 34,007,904 (GRCm39)	R113G	possibly damaging	Het
Epha5	A	T	5: 84,381,502 (GRCm39)	S450T	probably damaging	Het
Gm5581	A	T	6: 131,144,190 (GRCm39)		noncoding transcript	Het
Grhl3	A	G	4: 135,279,918 (GRCm39)	Y379H	probably damaging	Het
Herpud1	T	C	8: 95,117,454 (GRCm39)	S13P	probably benign	Het
Jam2	C	T	16: 84,606,435 (GRCm39)	Q150*	probably null	Het
Jph2	C	G	2: 163,217,668 (GRCm39)	R336P	probably damaging	Het
Kansl3	T	A	1: 36,387,764 (GRCm39)		probably null	Het
Kctd1	G	A	18: 15,195,580 (GRCm39)	P348S	probably damaging	Het
Klhl30	T	A	1: 91,285,106 (GRCm39)	S321T	possibly damaging	Het
Klhl5	T	C	5: 65,310,033 (GRCm39)		probably benign	Het
Letm2	T	C	8: 26,084,108 (GRCm39)	H41R	possibly damaging	Het
Ltn1	A	T	16: 87,194,679 (GRCm39)	C1407S	probably benign	Het
Map1b	T	C	13: 99,572,161 (GRCm39)	T187A	probably damaging	Het
Marveld2	T	C	13: 100,748,431 (GRCm39)	N216S	probably benign	Het
Matn1	A	G	4: 130,680,234 (GRCm39)	Y437C	probably damaging	Het
Oas1h	T	C	5: 121,009,159 (GRCm39)	Y290H	probably damaging	Het
Ofcc1	A	G	13: 40,417,035 (GRCm39)		probably null	Het
Or2m12	C	A	16: 19,104,726 (GRCm39)	G256W	probably damaging	Het
Or4k51	A	T	2: 111,584,750 (GRCm39)	D52V	probably damaging	Het
Or8g34	A	G	9: 39,373,183 (GRCm39)	Y152C	probably damaging	Het
Pcdh15	G	T	10: 74,215,249 (GRCm39)		probably null	Het
Pgk2	G	A	17: 40,518,412 (GRCm39)	P339S	probably damaging	Het
Piezo2	T	C	18: 63,186,032 (GRCm39)		probably null	Het
Prex2	A	G	1: 11,168,705 (GRCm39)	T234A	possibly damaging	Het
Rasgrf1	C	T	9: 89,826,922 (GRCm39)	T177M	probably benign	Het
Rgs1	A	T	1: 144,124,309 (GRCm39)		probably null	Het
Snx25	T	C	8: 46,521,229 (GRCm39)	N239S	probably damaging	Het
Spata31d1a	T	A	13: 59,849,716 (GRCm39)	H804L	possibly damaging	Het
Spon2	A	T	5: 33,371,896 (GRCm39)	Y303*	probably null	Het
Spopfm2	A	T	3: 94,082,841 (GRCm39)	C323*	probably null	Het
Thrb	G	A	14: 18,011,076 (GRCm38)	D151N	probably benign	Het
Tns1	A	G	1: 73,975,074 (GRCm39)	V1170A	probably benign	Het
Trbv19	A	T	6: 41,155,706 (GRCm39)	I26F	probably damaging	Het
Tstd2	T	C	4: 46,120,467 (GRCm39)	N311S	probably damaging	Het
Ttn	T	A	2: 76,715,746 (GRCm39)		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,139,706 (GRCm39)		probably benign	Het
Vmn1r185	G	A	7: 26,310,716 (GRCm39)	A263V	probably benign	Het
Zfp316	T	C	5: 143,239,169 (GRCm39)	H950R	probably damaging	Het
Zfp51	A	G	17: 21,676,615 (GRCm39)	K29E	probably benign	Het
Zfp644	T	C	5: 106,766,081 (GRCm39)		probably benign	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30,533,248 (GRCm39)	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30,532,967 (GRCm39)	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30,556,666 (GRCm39)	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30,543,097 (GRCm39)	critical splice donor site	probably null
IGL01019:Otof	APN	5	30,562,560 (GRCm39)	missense	probably benign	0.01
IGL01025:Otof	APN	5	30,541,597 (GRCm39)	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30,533,617 (GRCm39)	critical splice donor site	probably null
IGL01110:Otof	APN	5	30,619,069 (GRCm39)	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30,538,879 (GRCm39)	missense	probably benign	0.00
IGL01285:Otof	APN	5	30,562,527 (GRCm39)	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30,598,723 (GRCm39)	missense	probably benign	0.00
IGL01337:Otof	APN	5	30,576,856 (GRCm39)	missense	probably benign	0.17
IGL01337:Otof	APN	5	30,563,121 (GRCm39)	missense	possibly damaging	0.93
IGL01834:Otof	APN	5	30,556,564 (GRCm39)	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30,536,598 (GRCm39)	splice site	probably benign
IGL01969:Otof	APN	5	30,539,827 (GRCm39)	splice site	probably benign
IGL02075:Otof	APN	5	30,528,070 (GRCm39)	missense	probably benign	0.23
IGL02077:Otof	APN	5	30,556,579 (GRCm39)	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30,531,336 (GRCm39)	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30,528,128 (GRCm39)	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30,534,026 (GRCm39)	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30,531,426 (GRCm39)	missense	probably benign	0.08
IGL02864:Otof	APN	5	30,543,685 (GRCm39)	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30,562,520 (GRCm39)	splice site	probably null
R0285:Otof	UTSW	5	30,536,877 (GRCm39)	critical splice donor site	probably null
R0421:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30,529,225 (GRCm39)	splice site	probably benign
R0599:Otof	UTSW	5	30,528,049 (GRCm39)	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30,539,705 (GRCm39)	missense	probably benign	0.01
R0715:Otof	UTSW	5	30,552,041 (GRCm39)	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30,528,087 (GRCm39)	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30,529,256 (GRCm39)	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30,536,039 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1474:Otof	UTSW	5	30,536,876 (GRCm39)	critical splice donor site	probably null
R1524:Otof	UTSW	5	30,536,900 (GRCm39)	missense	probably benign	0.03
R1563:Otof	UTSW	5	30,528,349 (GRCm39)	missense	probably benign	0.00
R1732:Otof	UTSW	5	30,543,815 (GRCm39)	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30,536,054 (GRCm39)	missense	probably benign	0.00
R1845:Otof	UTSW	5	30,529,067 (GRCm39)	nonsense	probably null
R1925:Otof	UTSW	5	30,551,532 (GRCm39)	missense	probably benign	0.37
R1938:Otof	UTSW	5	30,533,713 (GRCm39)	missense	probably benign	0.00
R1968:Otof	UTSW	5	30,545,998 (GRCm39)	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30,578,381 (GRCm39)	missense	probably benign	0.01
R1999:Otof	UTSW	5	30,546,116 (GRCm39)	missense	probably benign	0.19
R2027:Otof	UTSW	5	30,578,358 (GRCm39)	missense	probably benign	0.08
R2138:Otof	UTSW	5	30,619,114 (GRCm39)	missense	probably benign	0.01
R2173:Otof	UTSW	5	30,543,718 (GRCm39)	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30,527,551 (GRCm39)	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30,540,184 (GRCm39)	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30,539,145 (GRCm39)	missense	probably benign	0.03
R3442:Otof	UTSW	5	30,529,033 (GRCm39)	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30,542,610 (GRCm39)	missense	probably benign
R3715:Otof	UTSW	5	30,534,215 (GRCm39)	nonsense	probably null
R3806:Otof	UTSW	5	30,543,843 (GRCm39)	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30,528,056 (GRCm39)	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30,556,635 (GRCm39)	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30,576,850 (GRCm39)	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30,539,762 (GRCm39)	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30,542,508 (GRCm39)	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30,532,344 (GRCm39)	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30,578,318 (GRCm39)	critical splice donor site	probably null
R4773:Otof	UTSW	5	30,552,026 (GRCm39)	missense	probably benign	0.05
R4839:Otof	UTSW	5	30,576,748 (GRCm39)	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30,536,005 (GRCm39)	critical splice donor site	probably null
R4991:Otof	UTSW	5	30,551,525 (GRCm39)	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30,540,238 (GRCm39)	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30,527,483 (GRCm39)	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30,534,064 (GRCm39)	missense	probably benign	0.01
R5365:Otof	UTSW	5	30,539,144 (GRCm39)	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30,532,323 (GRCm39)	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30,571,888 (GRCm39)	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30,529,279 (GRCm39)	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30,576,877 (GRCm39)	missense	probably benign
R6701:Otof	UTSW	5	30,528,141 (GRCm39)	nonsense	probably null
R6792:Otof	UTSW	5	30,532,978 (GRCm39)	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30,545,583 (GRCm39)	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30,528,987 (GRCm39)	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30,538,882 (GRCm39)	missense	probably benign	0.32
R7060:Otof	UTSW	5	30,545,700 (GRCm39)	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30,532,964 (GRCm39)	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30,540,878 (GRCm39)	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30,545,614 (GRCm39)	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30,527,614 (GRCm39)	missense	probably benign	0.45
R7397:Otof	UTSW	5	30,533,051 (GRCm39)	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30,542,532 (GRCm39)	missense	probably benign	0.04
R7428:Otof	UTSW	5	30,547,169 (GRCm39)	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30,552,005 (GRCm39)	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30,528,364 (GRCm39)	missense	probably benign	0.00
R7714:Otof	UTSW	5	30,527,597 (GRCm39)	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30,537,954 (GRCm39)	missense	probably benign	0.10
R8032:Otof	UTSW	5	30,619,142 (GRCm39)	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30,546,079 (GRCm39)	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8159:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8441:Otof	UTSW	5	30,538,200 (GRCm39)	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30,545,968 (GRCm39)	nonsense	probably null
R8813:Otof	UTSW	5	30,540,242 (GRCm39)	missense	probably benign	0.02
R8835:Otof	UTSW	5	30,528,264 (GRCm39)	missense	probably benign	0.44
R8852:Otof	UTSW	5	30,529,044 (GRCm39)	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30,578,325 (GRCm39)	missense	probably benign	0.08
R9029:Otof	UTSW	5	30,527,419 (GRCm39)	critical splice donor site	probably null
R9031:Otof	UTSW	5	30,537,532 (GRCm39)	missense	probably benign
R9061:Otof	UTSW	5	30,546,001 (GRCm39)	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30,539,696 (GRCm39)	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30,536,462 (GRCm39)	missense	probably benign	0.04
R9188:Otof	UTSW	5	30,534,095 (GRCm39)	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30,542,469 (GRCm39)	missense	probably benign
R9280:Otof	UTSW	5	30,528,894 (GRCm39)	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30,532,976 (GRCm39)	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30,540,863 (GRCm39)	critical splice donor site	probably null
R9407:Otof	UTSW	5	30,538,265 (GRCm39)	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30,539,708 (GRCm39)	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30,584,895 (GRCm39)	missense	probably benign	0.22
R9748:Otof	UTSW	5	30,540,998 (GRCm39)	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30,536,576 (GRCm39)	missense	probably benign
Z1176:Otof	UTSW	5	30,528,930 (GRCm39)	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30,541,002 (GRCm39)	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30,533,641 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCCAGGACTCCCAGGGTAAG -3'
(R):5'- CAGCATTCCTGATGTGTTCATTTG -3'

Sequencing Primer
(F):5'- GAGGTAGATAGAGCTTCACCTACC -3'
(R):5'- GTTCATTTGGATGATGAGCAACAAC -3'

Posted On

2016-04-27