Incidental Mutation 'R0401:1110002E22Rik'
List |< first << previous [record 89 of 386652] next >> last >|
ID38188
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 038606-MU
Accession Numbers
Stock #R0401 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138070306 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1752 (H1752L)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080] [ENSMUST00000184925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163080
AA Change: H1752L

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: H1752L

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik C A 18: 77,673,962 S218I probably damaging Het
A530099J19Rik A T 13: 19,729,494 Y129* probably null Het
Abcc5 T C 16: 20,376,558 K730E probably benign Het
Ahnak A G 19: 9,015,116 D4588G probably benign Het
AI467606 G A 7: 127,092,436 R61H probably damaging Het
Apoa4 T A 9: 46,243,058 V319E probably damaging Het
Atad5 T A 11: 80,120,699 D1297E probably benign Het
BC005624 G A 2: 30,980,009 T62I probably benign Het
Bcl6 T C 16: 23,972,594 K337E probably damaging Het
Cad T A 5: 31,073,986 noncoding transcript Het
Ccdc73 T C 2: 104,991,289 S528P probably benign Het
Ccng2 T G 5: 93,273,413 C261G possibly damaging Het
Cdh11 A T 8: 102,674,006 I110N probably damaging Het
Cgnl1 A G 9: 71,705,239 V767A probably damaging Het
Cit A G 5: 115,985,479 T1403A probably benign Het
Clec4b2 C T 6: 123,181,300 Q42* probably null Het
Clip1 A G 5: 123,653,789 V106A probably damaging Het
Crb1 T C 1: 139,198,791 noncoding transcript Het
Cts6 T C 13: 61,198,339 probably benign Het
Cul9 T C 17: 46,541,704 E244G probably damaging Het
Ddx55 A T 5: 124,567,951 I484F probably damaging Het
Dixdc1 A G 9: 50,693,674 S17P possibly damaging Het
Drosha T A 15: 12,926,031 Y1235* probably null Het
Dsg2 G T 18: 20,592,508 probably benign Het
E2f5 T C 3: 14,579,025 probably null Het
Epc2 A G 2: 49,528,974 T265A probably damaging Het
Etaa1 T G 11: 17,947,514 D201A probably damaging Het
Fancd2 T C 6: 113,548,343 I260T possibly damaging Het
Fhdc1 G A 3: 84,444,624 A1098V probably benign Het
Gm17689 G T 9: 36,582,628 A3E unknown Het
Gm7030 C T 17: 36,128,705 V128M probably damaging Het
Gpd2 G A 2: 57,340,093 V286I possibly damaging Het
Herc2 A C 7: 56,157,732 E2523A probably damaging Het
Jmjd1c G A 10: 67,220,382 R527H probably damaging Het
Kif12 G A 4: 63,169,525 noncoding transcript Het
Lrp2 A T 2: 69,479,148 N2802K probably damaging Het
Mab21l2 C G 3: 86,546,989 G235R probably benign Het
Mapk8 T C 14: 33,382,208 E417G probably benign Het
Mapk8ip3 G A 17: 24,909,171 noncoding transcript Het
Mettl1 A G 10: 127,045,077 T203A probably benign Het
Mettl9 T C 7: 121,076,313 V312A probably damaging Het
Mex3d A G 10: 80,386,894 V176A probably benign Het
Mmp3 T C 9: 7,449,790 S225P probably damaging Het
Mrvi1 G A 7: 110,876,897 P757S probably benign Het
Neb G A 2: 52,188,677 probably benign Het
Ninj2 C T 6: 120,198,051 A51V possibly damaging Het
Nle1 A G 11: 82,905,379 noncoding transcript Het
Nol9 T C 4: 152,052,605 Y532H probably benign Het
Nr2c1 T A 10: 94,171,158 V286E probably benign Het
Olfr1183 T G 2: 88,461,925 L195R probably damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr308 T C 7: 86,321,292 Y220C probably benign Het
Olfr481 T A 7: 108,080,872 I26N possibly damaging Het
Olfr670 T A 7: 104,959,943 H263L probably damaging Het
Olfr816 A G 10: 129,911,916 Y121H probably benign Het
Olfr827 A G 10: 130,210,620 L170P probably damaging Het
Ovch2 A T 7: 107,801,136 V15D probably damaging Het
Pclo T G 5: 14,681,734 S3417A unknown Het
Pet2 C A X: 89,405,209 R438L probably benign Het
Pex1 T A 5: 3,633,759 M1085K probably damaging Het
Plscr2 T C 9: 92,282,135 S6P probably benign Het
Pogz C T 3: 94,877,025 P722S possibly damaging Het
Pom121l2 A T 13: 21,982,225 D222V probably benign Het
Prpf40a T C 2: 53,159,313 Y221C possibly damaging Het
R3hdm2 A G 10: 127,458,173 I179V possibly damaging Het
Ranbp9 A C 13: 43,422,658 V355G probably damaging Het
Rims2 T C 15: 39,509,632 probably benign Het
Ryr2 A T 13: 11,705,684 S2693T probably benign Het
Sbno1 G A 5: 124,410,285 T111I probably damaging Het
Sdk1 A C 5: 142,046,161 N997T possibly damaging Het
Setx G T 2: 29,166,289 E2166* probably null Het
Skint7 T A 4: 111,980,362 N112K probably damaging Het
Slc35e1 T C 8: 72,492,571 T6A unknown Het
Slc4a10 A T 2: 62,190,848 D80V probably benign Het
Susd2 C A 10: 75,638,603 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcf3 G T 10: 80,421,158 S77R probably damaging Het
Tdpoz3 T C 3: 93,826,365 Y116H probably benign Het
Tex26 C A 5: 149,460,858 D164E probably benign Het
Thoc5 G A 11: 4,902,213 noncoding transcript Het
Tiparp A G 3: 65,531,436 R58G probably benign Het
Trim66 A T 7: 109,475,264 C597S probably damaging Het
Ugt2a3 T A 5: 87,336,490 Q225L probably benign Het
Vmn1r25 T A 6: 57,978,711 I198L probably benign Het
Vmn2r106 A T 17: 20,279,019 V210D possibly damaging Het
Vmn2r124 T C 17: 18,064,145 F483L probably damaging Het
Vmn2r78 A G 7: 86,921,311 K346E probably benign Het
Zfhx4 T A 3: 5,401,161 S2126R possibly damaging Het
Zfp608 C T 18: 54,898,994 G625R probably benign Het
Zkscan5 A G 5: 145,212,575 D234G probably damaging Het
Zscan10 T A 17: 23,605,915 V115E probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
JAX1:1110002E22Rik UTSW 3 138065658 nonsense probably null
JAX1:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACCCCGAGACAGGGCAATAC -3'
(R):5'- CACTCACCAGGAGCTGTTCCATTC -3'

Sequencing Primer
(F):5'- ATACGTGGATGTGCCCATGAC -3'
(R):5'- GTTCCATTCTGCTTTTTTTGAGACG -3'
Posted OnMay 23, 2013