Incidental Mutation 'R4962:Prune2'
ID381884
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission 042559-MU
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4962 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17122273 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1714 (F1714I)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: F1714I

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: F1714I

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226052
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,808 F317L possibly damaging Het
Abcc4 A G 14: 118,668,399 I85T probably benign Het
Acoxl G T 2: 128,075,890 C498F probably damaging Het
Akap13 C T 7: 75,749,430 T2752I probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ap2a2 T G 7: 141,630,148 F836C probably damaging Het
Atp2c1 A G 9: 105,442,950 V404A probably benign Het
Atp7b G T 8: 22,020,885 A415E probably damaging Het
Babam2 A T 5: 31,785,583 I71L possibly damaging Het
Bean1 A G 8: 104,216,974 T54A probably damaging Het
Cacna1b T A 2: 24,618,318 I1816F probably damaging Het
Cacna1b C T 2: 24,657,366 G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 E536G probably damaging Het
Cfap57 A G 4: 118,613,065 V206A probably benign Het
Clca2 A T 3: 145,077,879 D658E probably damaging Het
Cwc22 A T 2: 77,896,309 S809T probably benign Het
Cyp2c54 C T 19: 40,072,141 R132Q possibly damaging Het
Ddx20 A T 3: 105,680,605 D386E possibly damaging Het
Ddx50 T C 10: 62,642,853 T185A probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dennd4a T C 9: 64,906,003 S1415P probably benign Het
Dnah12 A T 14: 26,716,700 I495L probably benign Het
Dnah2 G A 11: 69,455,973 Q2596* probably null Het
Dnajb13 A G 7: 100,507,500 L123S probably benign Het
Elavl3 G A 9: 22,036,811 P19L probably benign Het
Fer1l6 T C 15: 58,571,401 S518P probably benign Het
Fgd3 T C 13: 49,266,629 S591G probably benign Het
Galnt18 C A 7: 111,472,064 R566L probably benign Het
Galnt6 A T 15: 100,696,574 Y525* probably null Het
Gm10036 A T 18: 15,833,302 Y170F probably benign Het
Hacd2 A G 16: 35,022,551 D24G unknown Het
Idh3a T C 9: 54,596,041 M128T possibly damaging Het
Ido1 C T 8: 24,584,549 M359I probably benign Het
Ikbkb T C 8: 22,681,677 T185A probably damaging Het
Insl6 C T 19: 29,321,619 G131D probably damaging Het
Irgm1 A C 11: 48,866,332 S217R possibly damaging Het
Itga11 T A 9: 62,761,568 Y702* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl2 T C 15: 98,531,843 M103V probably benign Het
Kcnq2 T C 2: 181,112,043 N258S possibly damaging Het
Kdm5d A T Y: 940,624 D1045V probably damaging Het
Lats2 A G 14: 57,699,592 L480P probably damaging Het
Lin28b T A 10: 45,420,640 K87N possibly damaging Het
Lpgat1 T A 1: 191,719,570 W103R probably damaging Het
Lpl G T 8: 68,894,693 G166C probably damaging Het
Ly75 A T 2: 60,352,125 Y569N probably damaging Het
Mcm8 A T 2: 132,838,769 E564D probably damaging Het
Me2 G T 18: 73,785,776 N411K probably damaging Het
Mn1 A G 5: 111,454,786 T1297A possibly damaging Het
Mphosph8 T A 14: 56,678,589 F447L probably benign Het
Nacad T A 11: 6,599,169 D1294V probably damaging Het
Neu3 A T 7: 99,823,408 F41I probably damaging Het
Nlrp6 G T 7: 140,923,584 L534F probably damaging Het
Nrap A G 19: 56,378,143 M338T probably damaging Het
Nuak1 T C 10: 84,375,115 K370E probably damaging Het
Olfr1151 A G 2: 87,857,288 T38A probably benign Het
Olfr1425 T A 19: 12,074,275 D119V probably damaging Het
Olfr479 T A 7: 108,055,440 C153S probably benign Het
Olfr805 C T 10: 129,722,723 V274M probably damaging Het
P3h3 T C 6: 124,841,773 S701G probably benign Het
Pdss2 T C 10: 43,298,912 M138T possibly damaging Het
Piezo1 C T 8: 122,486,481 E1848K probably benign Het
Prmt3 T G 7: 49,826,809 S389A probably benign Het
Prrxl1 G T 14: 32,647,144 probably benign Het
Ptgis A G 2: 167,225,274 probably null Het
Ptpn20 T C 14: 33,614,459 V85A probably benign Het
Rabepk A T 2: 34,780,657 Y264N probably damaging Het
Ralgapa2 A T 2: 146,434,834 C495* probably null Het
Satb2 A G 1: 56,891,168 I232T probably benign Het
Selenbp2 A T 3: 94,703,549 L307F probably damaging Het
Sgpl1 T G 10: 61,114,084 Y112S probably damaging Het
Slitrk5 T C 14: 111,681,247 S768P probably benign Het
Smc3 T A 19: 53,631,517 Y615N probably damaging Het
Spag17 A G 3: 100,027,623 N715S probably benign Het
Spats2 A G 15: 99,212,276 E518G probably benign Het
Spats2l A G 1: 57,885,824 H127R possibly damaging Het
Tenm3 T A 8: 48,278,961 K1287* probably null Het
Thoc1 T A 18: 9,962,387 S91T probably benign Het
Thoc6 C T 17: 23,669,937 G166S probably damaging Het
Tmem107 C A 11: 69,071,261 T42N possibly damaging Het
Tmprss11c A G 5: 86,237,710 I288T probably damaging Het
Tnrc18 A G 5: 142,739,493 F1827S unknown Het
Trmt112 C A 19: 6,910,198 T5N probably damaging Het
Trp53bp1 A T 2: 121,270,546 M57K probably benign Het
Ttbk2 C A 2: 120,745,150 Q1115H probably damaging Het
Ttn C A 2: 76,729,645 E27725* probably null Het
Ttn A G 2: 76,944,109 M2151T probably damaging Het
Usp9y A T Y: 1,384,336 D727E probably damaging Het
Vps13c A G 9: 67,873,891 T221A probably damaging Het
Zbtb20 A G 16: 43,618,692 D725G probably damaging Het
Zfp341 A T 2: 154,626,814 I126F possibly damaging Het
Zfyve16 C T 13: 92,513,894 A861T probably damaging Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense not run
R7102:Prune2 UTSW 19 17121213 missense not run
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGATCTAACGACTAAACGTC -3'
(R):5'- GCCACGTGGTATCCATTGTC -3'

Sequencing Primer
(F):5'- TCTAACGACTAAACGTCAAGAGG -3'
(R):5'- CCGTTTCTGCAGCTCTGG -3'
Posted On2016-04-27