Incidental Mutation 'R4950:Fez1'
ID381925
Institutional Source Beutler Lab
Gene Symbol Fez1
Ensembl Gene ENSMUSG00000032118
Gene Namefasciculation and elongation protein zeta 1 (zygin I)
SynonymsUNC-76, UNC76
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location36821864-36878924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36867882 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 285 (R285Q)
Ref Sequence ENSEMBL: ENSMUSP00000126072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000161500] [ENSMUST00000162235] [ENSMUST00000163816]
Predicted Effect probably damaging
Transcript: ENSMUST00000034630
AA Change: R285Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118
AA Change: R285Q

DomainStartEndE-ValueType
Pfam:FEZ 58 300 3.4e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159137
Predicted Effect probably benign
Transcript: ENSMUST00000160041
SMART Domains Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 35 87 4.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161500
SMART Domains Protein: ENSMUSP00000123762
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 167 5.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161978
Predicted Effect probably benign
Transcript: ENSMUST00000162235
Predicted Effect probably damaging
Transcript: ENSMUST00000163816
AA Change: R285Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118
AA Change: R285Q

DomainStartEndE-ValueType
Pfam:FEZ 58 297 2.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216539
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Fez1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Fez1 APN 9 36850399 missense probably damaging 0.97
R1280:Fez1 UTSW 9 36870549 frame shift probably null
R1458:Fez1 UTSW 9 36870549 frame shift probably null
R1741:Fez1 UTSW 9 36843733 missense probably damaging 1.00
R1846:Fez1 UTSW 9 36867767 missense probably damaging 1.00
R2072:Fez1 UTSW 9 36867945 missense probably benign 0.00
R4193:Fez1 UTSW 9 36843727 missense probably damaging 1.00
R4214:Fez1 UTSW 9 36870488 missense probably damaging 0.99
R4417:Fez1 UTSW 9 36870472 splice site probably benign
R4696:Fez1 UTSW 9 36870470 splice site probably null
R4735:Fez1 UTSW 9 36860845 nonsense probably null
R4947:Fez1 UTSW 9 36868875 missense probably damaging 0.99
R5538:Fez1 UTSW 9 36868876 missense probably damaging 1.00
R5618:Fez1 UTSW 9 36843932 missense probably damaging 1.00
R5742:Fez1 UTSW 9 36850447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACATGTCTGGGTCTGAGC -3'
(R):5'- CATTGCCCTGTCACAAAGTTC -3'

Sequencing Primer
(F):5'- CTGGGTCTGAGCTGACAGAG -3'
(R):5'- CAGTAACTGTTTCGGGGTCCAC -3'
Posted On2016-04-27