Incidental Mutation 'R4951:Msh5'
ID382016
Institutional Source Beutler Lab
Gene Symbol Msh5
Ensembl Gene ENSMUSG00000007035
Gene NamemutS homolog 5
SynonymsMut5, G7
MMRRC Submission 042548-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4951 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35028605-35046745 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 35038420 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 333 (Q333*)
Ref Sequence ENSEMBL: ENSMUSP00000134065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007250] [ENSMUST00000097338] [ENSMUST00000172536] [ENSMUST00000174556] [ENSMUST00000174603]
Predicted Effect probably null
Transcript: ENSMUST00000007250
AA Change: Q333*
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035
AA Change: Q333*

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000097338
AA Change: Q333*
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035
AA Change: Q333*

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165329
Predicted Effect probably null
Transcript: ENSMUST00000172536
AA Change: Q333*
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035
AA Change: Q333*

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173685
Predicted Effect probably benign
Transcript: ENSMUST00000174556
SMART Domains Protein: ENSMUSP00000134061
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174603
AA Change: Q333*
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035
AA Change: Q333*

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Meta Mutation Damage Score 0.676 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A G 9: 35,839,436 V30A probably damaging Het
Adcy1 G A 11: 7,138,336 E452K possibly damaging Het
Adcy10 T C 1: 165,563,963 L1263P probably damaging Het
Adgrg1 G A 8: 95,005,246 V179M probably damaging Het
Agap1 T A 1: 89,609,503 V77E probably damaging Het
Ahnak A T 19: 9,017,835 K5494N probably damaging Het
Arhgap19 A G 19: 41,774,106 M437T probably benign Het
C2cd4c C A 10: 79,613,005 A103S possibly damaging Het
Clip1 A T 5: 123,630,345 D776E probably benign Het
Cntn3 C T 6: 102,169,025 V952M possibly damaging Het
Col6a6 A G 9: 105,767,198 probably null Het
Crtac1 C T 19: 42,414,131 A13T probably benign Het
Ddx50 C T 10: 62,634,120 A363T probably damaging Het
Dock9 A G 14: 121,653,135 V241A probably benign Het
Dysf T C 6: 84,114,120 probably null Het
Enpp3 A T 10: 24,798,277 M375K probably damaging Het
Fam13c G A 10: 70,551,791 probably null Het
Ftcd C T 10: 76,584,683 A417V probably benign Het
Gak A G 5: 108,582,718 S941P probably benign Het
Ganc A G 2: 120,456,047 T786A probably benign Het
Gfi1 A C 5: 107,720,143 S420A probably damaging Het
Ghsr A T 3: 27,372,361 T189S possibly damaging Het
Glb1l C T 1: 75,208,375 G122D probably damaging Het
Gm10065 C T 13: 21,479,251 S64N unknown Het
Gm5087 C A 14: 13,158,749 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 G A 1: 59,541,474 probably null Het
Gm9930 A T 10: 9,534,705 noncoding transcript Het
H6pd A T 4: 149,981,587 Y781N probably damaging Het
Ide G A 19: 37,285,232 L695F unknown Het
Il17re T A 6: 113,468,907 V393E probably damaging Het
Lipo1 A G 19: 33,782,221 V205A probably benign Het
Lipo5 C T 19: 33,468,851 E49K probably damaging Het
Lonp1 A T 17: 56,620,335 M306K possibly damaging Het
Lrig1 A G 6: 94,663,978 L82P probably damaging Het
Lrp2 A T 2: 69,535,988 C256S probably damaging Het
Map1b A T 13: 99,432,427 I1262K unknown Het
Mctp1 C T 13: 76,827,775 P756S probably damaging Het
Mdn1 T A 4: 32,707,459 W1583R probably damaging Het
Mis12 T A 11: 71,025,647 Y169N probably benign Het
Necap2 A T 4: 141,072,523 probably null Het
Nfatc2 T C 2: 168,571,072 D211G probably damaging Het
Nlrx1 A G 9: 44,253,429 V906A possibly damaging Het
Olfr1239 T A 2: 89,417,772 I214F probably benign Het
Olfr1456-ps1 A T 19: 13,079,256 noncoding transcript Het
Olfr320 G A 11: 58,684,763 V297I probably damaging Het
Olfr723 A T 14: 49,929,058 L162* probably null Het
Olfr938 A G 9: 39,078,259 F162S probably benign Het
Pkhd1l1 T A 15: 44,533,891 N2057K possibly damaging Het
Ppip5k2 T C 1: 97,711,749 K1078R possibly damaging Het
Prdm11 A G 2: 92,980,609 I215T probably damaging Het
Ptpn13 C T 5: 103,588,046 P2137L probably benign Het
Rif1 T A 2: 52,084,986 probably null Het
Rnf17 T C 14: 56,522,391 V1551A probably benign Het
Ror2 C T 13: 53,117,147 V391I probably benign Het
Rps6ka2 A T 17: 7,292,789 D542V probably damaging Het
Sema4g A G 19: 44,996,571 probably null Het
Serpinb6d T G 13: 33,666,383 S64R probably benign Het
Serpine1 C T 5: 137,069,351 R156K probably benign Het
Setdb2 A G 14: 59,402,303 I713T possibly damaging Het
Slamf7 A G 1: 171,639,125 F171L probably benign Het
Slc15a5 A G 6: 138,073,066 L117S probably damaging Het
Slc8a3 T A 12: 81,314,699 T449S probably benign Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Smc2 G A 4: 52,462,926 V639M possibly damaging Het
Sra1 A T 18: 36,676,441 C223* probably null Het
Srgap1 A T 10: 121,785,552 M1012K probably benign Het
Stk-ps2 A T 1: 46,029,442 noncoding transcript Het
Taar6 A T 10: 23,985,208 S147T probably benign Het
Taf15 G A 11: 83,484,811 G34D possibly damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tob2 T C 15: 81,851,723 Y15C probably damaging Het
Trim12a A G 7: 104,304,358 V182A possibly damaging Het
Trim67 A G 8: 124,794,667 E256G probably benign Het
Trrap T A 5: 144,805,720 S1382T possibly damaging Het
Ttc39d T A 17: 80,216,033 S40R probably benign Het
Ttn A T 2: 76,949,062 V1158E probably benign Het
Vmn1r19 C T 6: 57,404,942 T160I probably benign Het
Vmn2r100 T C 17: 19,532,038 I781T probably benign Het
Vmn2r85 T C 10: 130,425,244 E408G probably damaging Het
Vwde T C 6: 13,187,139 D783G probably damaging Het
Wdr27 A T 17: 14,876,133 D796E probably damaging Het
Zfp365 C T 10: 67,889,991 probably null Het
Zfp9 T G 6: 118,464,447 H418P probably damaging Het
Other mutations in Msh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Msh5 APN 17 35029881 nonsense probably null
IGL00491:Msh5 APN 17 35030730 missense probably damaging 0.96
IGL01364:Msh5 APN 17 35028769 missense possibly damaging 0.70
R0189:Msh5 UTSW 17 35029654 missense probably null 0.97
R0257:Msh5 UTSW 17 35032864 missense probably damaging 0.99
R0346:Msh5 UTSW 17 35029888 missense probably benign 0.09
R0449:Msh5 UTSW 17 35041482 missense probably benign 0.09
R0645:Msh5 UTSW 17 35039223 missense probably damaging 1.00
R1925:Msh5 UTSW 17 35029952 missense probably benign 0.00
R1929:Msh5 UTSW 17 35044390 missense probably benign 0.24
R1970:Msh5 UTSW 17 35033600 missense probably damaging 0.99
R2025:Msh5 UTSW 17 35032792 missense possibly damaging 0.90
R2038:Msh5 UTSW 17 35046040 missense probably benign 0.12
R2058:Msh5 UTSW 17 35029756 missense probably damaging 0.99
R2271:Msh5 UTSW 17 35044390 missense probably benign 0.24
R2408:Msh5 UTSW 17 35045119 missense probably damaging 1.00
R3079:Msh5 UTSW 17 35046232 missense probably benign 0.41
R4409:Msh5 UTSW 17 35039250 missense probably damaging 0.98
R4513:Msh5 UTSW 17 35030688 missense possibly damaging 0.89
R4878:Msh5 UTSW 17 35038456 missense probably damaging 1.00
R5037:Msh5 UTSW 17 35032393 missense possibly damaging 0.80
R5063:Msh5 UTSW 17 35042188 splice site probably null
R5064:Msh5 UTSW 17 35043783 intron probably benign
R5103:Msh5 UTSW 17 35029239 missense possibly damaging 0.96
R5872:Msh5 UTSW 17 35029652 critical splice donor site probably null
R6320:Msh5 UTSW 17 35029924 missense probably damaging 0.97
R6869:Msh5 UTSW 17 35041834 intron probably null
R6997:Msh5 UTSW 17 35030002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGTCTAGACACAGGCCAC -3'
(R):5'- GGTGACTCTGTGTGGAGAAC -3'

Sequencing Primer
(F):5'- CACGAAGGCTTGACTTGAACTTCTG -3'
(R):5'- AACACCCATGTGAGTGTGG -3'
Posted On2016-04-27