Incidental Mutation 'R4952:Stoml2'
ID382043
Institutional Source Beutler Lab
Gene Symbol Stoml2
Ensembl Gene ENSMUSG00000028455
Gene Namestomatin (Epb7.2)-like 2
Synonyms0610038F01Rik, SLP-2
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43027690-43031710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43029589 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 164 (T164A)
Ref Sequence ENSEMBL: ENSMUSP00000117586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000067481] [ENSMUST00000098109] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
AA Change: T210A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455
AA Change: T210A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036462
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067481
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098109
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107956
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107957
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107958
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107959
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131506
Predicted Effect probably benign
Transcript: ENSMUST00000135067
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135660
AA Change: T168A
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455
AA Change: T168A

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136326
AA Change: T164A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455
AA Change: T164A

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143371
Predicted Effect probably benign
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated in T cells exhibit normal mitochondria migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Stoml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Stoml2 APN 4 43029366 unclassified probably benign
IGL02498:Stoml2 APN 4 43031045 missense probably benign 0.01
IGL03185:Stoml2 APN 4 43029065 missense probably benign 0.13
R0329:Stoml2 UTSW 4 43030238 critical splice donor site probably null
R0330:Stoml2 UTSW 4 43030238 critical splice donor site probably null
R1344:Stoml2 UTSW 4 43028197 missense probably benign 0.00
R2202:Stoml2 UTSW 4 43030243 nonsense probably null
R2203:Stoml2 UTSW 4 43030243 nonsense probably null
R2204:Stoml2 UTSW 4 43030243 nonsense probably null
R2205:Stoml2 UTSW 4 43030243 nonsense probably null
R4804:Stoml2 UTSW 4 43029882 missense probably benign 0.01
R5837:Stoml2 UTSW 4 43028989 missense probably damaging 1.00
R5845:Stoml2 UTSW 4 43030008 unclassified probably benign
R5882:Stoml2 UTSW 4 43031003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCATGCAATTAGAGAAGCC -3'
(R):5'- CTCGAGTGAAAGAGTCTATGCAG -3'

Sequencing Primer
(F):5'- GAAGCCCAAAGCCTCTGTC -3'
(R):5'- GGTAGGGAAACAGATTGGGTTACTCC -3'
Posted On2016-04-27