Incidental Mutation 'R4952:Mag'
ID382056
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Namemyelin-associated glycoprotein
SynonymsGma, siglec-4a
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30899176-30914873 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 30909156 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 178 (E178*)
Ref Sequence ENSEMBL: ENSMUSP00000139881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000190638] [ENSMUST00000190950] [ENSMUST00000191081]
Predicted Effect probably null
Transcript: ENSMUST00000040548
AA Change: E178*
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634
AA Change: E178*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186422
Predicted Effect probably null
Transcript: ENSMUST00000187137
AA Change: E178*
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634
AA Change: E178*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188569
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190638
SMART Domains Protein: ENSMUSP00000140578
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
Blast:IG 144 168 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190950
SMART Domains Protein: ENSMUSP00000139861
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
Blast:CLECT 1 64 3e-39 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000191081
AA Change: E178*
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634
AA Change: E178*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191486
Meta Mutation Damage Score 0.656 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30900387 missense probably benign 0.00
IGL02036:Mag APN 7 30908452 missense probably damaging 0.97
IGL03263:Mag APN 7 30899528 unclassified probably null
regie UTSW 7 30900729 missense probably damaging 0.98
R0005:Mag UTSW 7 30908354 splice site probably benign
R0403:Mag UTSW 7 30906980 missense probably damaging 1.00
R1590:Mag UTSW 7 30901852 missense probably damaging 0.99
R1874:Mag UTSW 7 30909051 missense probably benign 0.13
R2170:Mag UTSW 7 30908987 nonsense probably null
R2192:Mag UTSW 7 30900641 nonsense probably null
R3176:Mag UTSW 7 30901648 critical splice donor site probably null
R3177:Mag UTSW 7 30901648 critical splice donor site probably null
R3276:Mag UTSW 7 30901648 critical splice donor site probably null
R3277:Mag UTSW 7 30901648 critical splice donor site probably null
R4540:Mag UTSW 7 30900729 missense probably damaging 0.98
R4635:Mag UTSW 7 30906923 missense probably damaging 1.00
R4704:Mag UTSW 7 30909173 missense probably damaging 1.00
R4891:Mag UTSW 7 30900368 missense probably benign 0.04
R4940:Mag UTSW 7 30909200 missense probably damaging 1.00
R6301:Mag UTSW 7 30900679 missense probably damaging 1.00
R6441:Mag UTSW 7 30907083 missense possibly damaging 0.65
R6951:Mag UTSW 7 30911433 missense possibly damaging 0.89
R7562:Mag UTSW 7 30909134 missense possibly damaging 0.83
X0024:Mag UTSW 7 30907071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGACGTCCAAACTGGCG -3'
(R):5'- CTGGGCATTCAGAGGGATAAAGTC -3'

Sequencing Primer
(F):5'- GTAACCCTCGAACTGCAAGGTG -3'
(R):5'- ACAGGTGGGCCAGACGAC -3'
Posted On2016-04-27