Incidental Mutation 'R4952:Plxnb1'
ID382069
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109114836 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1969 (F1969L)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: F1969L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: F1969L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGCTGGATGAACAAGCTC -3'
(R):5'- AAGCCCTGAAGATCTGTGCC -3'

Sequencing Primer
(F):5'- CAGCAGCATGGCATCTCTGATC -3'
(R):5'- ACCAGCTACATGGGTGTCATC -3'
Posted On2016-04-27