Incidental Mutation 'R4959:Rttn'
ID382216
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission 042556-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4959 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89042168 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 998 (H998L)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
Predicted Effect probably damaging
Transcript: ENSMUST00000023828
AA Change: H998L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: H998L

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Aadacl3 A T 4: 144,457,086 C136S probably benign Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Acrv1 G A 9: 36,694,700 probably null Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atm A T 9: 53,515,301 D552E probably benign Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Ccser2 A T 14: 36,940,796 S144T probably benign Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Crb2 G T 2: 37,790,470 R470L probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Dsp C T 13: 38,191,710 A1157V probably benign Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam187b T A 7: 30,982,262 H131Q probably damaging Het
Fam193b A G 13: 55,543,284 I259T probably damaging Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo38 A T 18: 62,522,507 N369K probably benign Het
Fitm1 T A 14: 55,576,374 probably null Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fryl A T 5: 73,035,058 M2678K probably benign Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm3233 T C 10: 77,759,565 probably benign Het
Gzmd T G 14: 56,132,498 T9P unknown Het
Htr2b A T 1: 86,100,091 I231N probably damaging Het
Il2ra A G 2: 11,676,853 T90A possibly damaging Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kif21b G A 1: 136,148,370 C299Y possibly damaging Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mapk1 T A 16: 17,018,306 M106K probably damaging Het
Mpp2 A G 11: 102,063,291 V193A probably damaging Het
Muc4 T C 16: 32,754,319 S1398P possibly damaging Het
Ndufs2 A G 1: 171,238,009 Y282H probably damaging Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Ngef A G 1: 87,503,348 F159S possibly damaging Het
Nlrx1 T C 9: 44,254,151 H816R possibly damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr381 A T 11: 73,486,067 Y252* probably null Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Pcgf2 A T 11: 97,691,689 Y7N possibly damaging Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Prl3c1 G T 13: 27,202,488 probably null Het
Ptpn4 A T 1: 119,765,096 Y110* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Rd3l C T 12: 111,980,144 probably null Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Simc1 T G 13: 54,525,318 V493G possibly damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc25a46 A T 18: 31,602,754 I144N possibly damaging Het
Smtn A T 11: 3,527,825 M1K probably null Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Spata31d1d C T 13: 59,727,288 G811D probably damaging Het
Spta1 A C 1: 174,246,608 D2371A probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Stim2 G T 5: 54,105,370 R318L probably benign Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Suz12 G A 11: 80,029,231 G539D probably damaging Het
Sytl2 C G 7: 90,376,037 S411C probably damaging Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Thada T C 17: 84,444,183 Y455C probably damaging Het
Tlr6 G C 5: 64,953,659 T635S possibly damaging Het
Tlr9 A G 9: 106,224,677 D389G probably benign Het
Tmem54 A T 4: 129,108,280 H40L probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Trrap A T 5: 144,856,960 H3384L probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Vat1 G A 11: 101,460,600 T305M probably damaging Het
Vmn2r85 A G 10: 130,421,433 S544P probably damaging Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Ylpm1 T A 12: 85,049,945 V1242E probably damaging Het
Zfp322a T C 13: 23,356,882 Y230C probably damaging Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp936 A T 7: 43,189,610 H167L probably damaging Het
Zkscan14 A G 5: 145,195,492 Y410H probably benign Het
Zkscan17 A G 11: 59,503,712 M21T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 intron probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 intron probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTTTCAGGGAACACTGGC -3'
(R):5'- CTTGGGTACACATTGAGCTTTAC -3'

Sequencing Primer
(F):5'- TCAGGGAACACTGGCTATCTC -3'
(R):5'- ACACATTGAGCTTTACTCTTTCCAAG -3'
Posted On2016-04-27