Incidental Mutation 'R4960:Cp'
ID382238
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 042557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4960 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19973797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 456 (V456I)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003714
AA Change: V456I

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: V456I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091309
AA Change: V456I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: V456I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108325
AA Change: V456I

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: V456I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108328
AA Change: V456I

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: V456I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108329
AA Change: V456I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: V456I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G T 8: 105,283,211 R369S probably damaging Het
Abcc9 A T 6: 142,620,783 probably null Het
Adamts20 T C 15: 94,379,774 H269R probably benign Het
Adamtsl1 C T 4: 86,424,173 Q1642* probably null Het
Adamtsl3 A C 7: 82,566,977 T863P probably damaging Het
Adcy3 G T 12: 4,134,896 V191L probably benign Het
Akap9 G T 5: 3,957,664 R244L probably benign Het
Als2cr12 T A 1: 58,667,806 E234V probably damaging Het
Anapc1 C T 2: 128,684,594 V95M probably benign Het
Arhgap17 G T 7: 123,286,926 probably benign Het
Arntl T A 7: 113,299,435 probably null Het
Art2b T A 7: 101,580,230 Y154F probably damaging Het
Atrn C T 2: 130,995,047 R1144* probably null Het
Atxn3 T C 12: 101,948,379 S29G possibly damaging Het
Batf3 C T 1: 191,098,510 P18S probably benign Het
Bmpr1b A T 3: 141,870,785 C96S probably damaging Het
Bola1 A G 3: 96,197,054 S75P probably benign Het
Btbd11 A C 10: 85,651,662 N998T probably benign Het
Cela3a G A 4: 137,402,648 R221* probably null Het
Chat A G 14: 32,420,814 V406A possibly damaging Het
Chd1 T A 17: 15,742,231 M750K probably damaging Het
Clip1 T A 5: 123,654,003 K35* probably null Het
Cnr2 G A 4: 135,917,607 G332D probably benign Het
Cnrip1 A G 11: 17,052,228 D20G probably damaging Het
Col2a1 T C 15: 97,976,149 Y1384C unknown Het
Col6a3 T A 1: 90,804,218 I831F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctbp2 T C 7: 133,014,238 I323V probably benign Het
Ctnna2 C T 6: 77,653,111 R120H probably damaging Het
Cyp2a12 A G 7: 27,034,150 H318R probably benign Het
Cyp2c66 A T 19: 39,163,322 probably null Het
Cyp2j8 T C 4: 96,507,377 T4A probably benign Het
Cyp4v3 A G 8: 45,320,637 V165A possibly damaging Het
D5Ertd579e G A 5: 36,616,227 R275* probably null Het
Deup1 G T 9: 15,600,968 Q160K possibly damaging Het
Dhx36 A T 3: 62,496,859 I221K probably damaging Het
Dnah7b T A 1: 46,233,726 M2338K probably benign Het
Dync2li1 T G 17: 84,633,541 L62V probably benign Het
Ephb3 A G 16: 21,220,495 K367R probably benign Het
Etv3 A G 3: 87,528,061 K80E probably damaging Het
Gdap1l1 T C 2: 163,453,859 F346L probably benign Het
Gm12794 T C 4: 101,941,464 Y211H probably benign Het
Gm4787 C T 12: 81,379,316 V23M probably damaging Het
Greb1l T A 18: 10,547,306 I1508N probably damaging Het
Heatr5b G A 17: 78,831,584 T43I probably benign Het
Hephl1 T C 9: 15,086,290 Y360C probably damaging Het
Itgam A C 7: 128,115,840 T865P possibly damaging Het
Kcnma1 T C 14: 24,004,118 probably benign Het
Kidins220 T A 12: 24,992,260 C185* probably null Het
Klhl35 G T 7: 99,469,068 G273V probably damaging Het
Lama5 A G 2: 180,208,252 probably null Het
Lamc3 A G 2: 31,915,954 Q689R probably benign Het
Lnx2 C T 5: 147,019,040 V649I probably benign Het
Lrrc43 A G 5: 123,499,612 I281V probably benign Het
Ly6g6d C A 17: 35,071,754 A67S probably benign Het
Map1b A G 13: 99,432,212 S1334P probably benign Het
Marc2 T A 1: 184,833,919 M186L probably benign Het
Mast1 T A 8: 84,917,871 T810S probably benign Het
Mbnl1 A G 3: 60,595,696 M1V probably null Het
Mc5r T G 18: 68,338,819 M83R possibly damaging Het
Mkln1 T C 6: 31,459,006 F300S probably damaging Het
Mrgpre A T 7: 143,781,351 C138* probably null Het
Ncbp1 C T 4: 46,165,273 Q529* probably null Het
Nrcam A G 12: 44,566,299 D591G probably benign Het
Nrxn3 A T 12: 88,795,201 H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,617,861 probably benign Het
Olfr1318 A G 2: 112,156,352 T134A probably benign Het
Olfr202 A G 16: 59,283,985 S171P probably benign Het
Olfr459 C A 6: 41,772,069 V77F probably damaging Het
Olfr667 A G 7: 104,916,708 I196T probably benign Het
Olfr794 A C 10: 129,571,026 I124L probably damaging Het
Omt2a T A 9: 78,313,023 E31D possibly damaging Het
Phyhipl A G 10: 70,568,985 V131A probably benign Het
Pik3r5 A G 11: 68,493,638 M619V probably benign Het
Ptprg A T 14: 12,237,837 E1431D probably benign Het
Rnf20 A G 4: 49,638,029 T85A probably damaging Het
Rtn3 A T 19: 7,456,521 I683K probably damaging Het
Rwdd3 A G 3: 121,158,821 F174L probably damaging Het
Ryr1 T C 7: 29,078,783 Q2096R possibly damaging Het
Scrn1 T C 6: 54,534,422 D111G probably damaging Het
Sema3e A G 5: 14,252,632 R724G possibly damaging Het
She A G 3: 89,834,237 M232V possibly damaging Het
Slc25a54 A T 3: 109,112,816 N382I possibly damaging Het
Slc26a2 T C 18: 61,198,803 M519V probably damaging Het
Slc9a1 T A 4: 133,370,656 L38H probably damaging Het
Slc9a3r1 A G 11: 115,176,463 D180G probably benign Het
Snap47 A T 11: 59,428,543 D256E probably damaging Het
Tacc3 A G 5: 33,671,982 T610A probably benign Het
Tbc1d30 G A 10: 121,267,216 T637M probably benign Het
Tbcd T A 11: 121,573,855 M572K probably benign Het
Thoc7 A T 14: 13,953,460 D68E probably benign Het
Tmpo G A 10: 91,153,309 T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,443,947 probably benign Het
Tnfaip1 A T 11: 78,527,570 C224S possibly damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Tspoap1 C T 11: 87,766,396 Q345* probably null Het
Ttc21a A G 9: 119,945,001 E258G possibly damaging Het
Ttc37 T A 13: 76,185,156 V1508E possibly damaging Het
Ttyh1 T C 7: 4,128,226 L232P probably damaging Het
Usp2 T A 9: 44,075,813 L136Q probably damaging Het
Usp31 T C 7: 121,648,645 S1192G probably damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGGTTGAAGAAAGTGTAGATACTCC -3'
(R):5'- ATGGGCAGTCGTTGGTATCC -3'

Sequencing Primer
(F):5'- AGTTTCCTGATGTGCAAGTTTTAC -3'
(R):5'- AGTCGTTGGTATCCTGCCTTCAG -3'
Posted On2016-04-27