Incidental Mutation 'R0401:Tcf3'
ID38230
Institutional Source Beutler Lab
Gene Symbol Tcf3
Ensembl Gene ENSMUSG00000020167
Gene Nametranscription factor 3
SynonymsA1, ALF2, bHLHb21, E12, E2A, E47, Pan1, Pan2, Tcfe2a
MMRRC Submission 038606-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0401 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80409514-80433647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80421158 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 77 (S77R)
Ref Sequence ENSEMBL: ENSMUSP00000100980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020377] [ENSMUST00000020379] [ENSMUST00000105339] [ENSMUST00000105340] [ENSMUST00000105341] [ENSMUST00000105342] [ENSMUST00000105343] [ENSMUST00000105344] [ENSMUST00000105345] [ENSMUST00000105346] [ENSMUST00000156244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020377
AA Change: S77R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020377
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
HLH 553 606 2.66e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000020379
AA Change: S77R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020379
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105339
AA Change: S77R

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100976
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
HLH 549 602 2.66e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105340
AA Change: S77R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100977
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105341
AA Change: S77R

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100978
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
HLH 546 599 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105342
AA Change: S77R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100979
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
HLH 554 607 2.66e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105343
AA Change: S77R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100980
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105344
AA Change: S77R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100981
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
HLH 551 604 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105345
AA Change: S77R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100982
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105346
AA Change: S77R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100983
Gene: ENSMUSG00000020167
AA Change: S77R

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
HLH 552 605 2.66e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127931
Predicted Effect probably damaging
Transcript: ENSMUST00000156244
AA Change: S41R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120303
Gene: ENSMUSG00000020167
AA Change: S41R

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156990
AA Change: S68R
SMART Domains Protein: ENSMUSP00000121172
Gene: ENSMUSG00000020167
AA Change: S68R

DomainStartEndE-ValueType
low complexity region 47 65 N/A INTRINSIC
low complexity region 117 140 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
low complexity region 451 469 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
HLH 539 592 8.79e-11 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1;19), with PBX1), childhood leukemia (t(19;19), with TFPT) and acute leukemia (t(12;19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations are devoid of mature B cells, have a partial early block in T-lymphocyte development, and show high postnatal mortality. Many survivors develop T-cell lymphomas between 3 and 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,070,306 H1752L possibly damaging Het
8030462N17Rik C A 18: 77,673,962 S218I probably damaging Het
A530099J19Rik A T 13: 19,729,494 noncoding transcript Het
Abcc5 T C 16: 20,376,558 K730E probably benign Het
Ahnak A G 19: 9,015,116 D4588G probably benign Het
AI467606 G A 7: 127,092,436 R61H probably damaging Het
Apoa4 T A 9: 46,243,058 V319E probably damaging Het
Atad5 T A 11: 80,120,699 D1297E probably benign Het
BC005624 G A 2: 30,980,009 T62I probably benign Het
Bcl6 T C 16: 23,972,594 K337E probably damaging Het
Cad T A 5: 31,073,986 probably benign Het
Ccdc73 T C 2: 104,991,289 S528P probably benign Het
Ccng2 T G 5: 93,273,413 C261G possibly damaging Het
Cdh11 A T 8: 102,674,006 I110N probably damaging Het
Cgnl1 A G 9: 71,705,239 V767A probably damaging Het
Cit A G 5: 115,985,479 T1460A probably benign Het
Clec4b2 C T 6: 123,181,300 Q42* probably null Het
Clip1 A G 5: 123,653,789 V106A probably damaging Het
Crb1 T C 1: 139,198,791 probably benign Het
Cts6 T C 13: 61,198,339 probably benign Het
Cul9 T C 17: 46,541,704 E244G probably damaging Het
Ddx55 A T 5: 124,567,951 I480F probably damaging Het
Dixdc1 A G 9: 50,693,674 S17P possibly damaging Het
Drosha T A 15: 12,926,031 Y1235* probably null Het
Dsg2 G T 18: 20,592,508 probably benign Het
E2f5 T C 3: 14,579,025 probably null Het
Epc2 A G 2: 49,528,974 T265A probably damaging Het
Etaa1 T G 11: 17,947,514 D201A probably damaging Het
Fancd2 T C 6: 113,548,343 I260T possibly damaging Het
Fhdc1 G A 3: 84,444,624 A1098V probably benign Het
Gm17689 G T 9: 36,582,628 A3E unknown Het
Gm7030 C T 17: 36,128,705 V128M probably damaging Het
Gpd2 G A 2: 57,340,093 V286I possibly damaging Het
Herc2 A C 7: 56,157,732 E2523A probably damaging Het
Jmjd1c G A 10: 67,220,382 R527H probably damaging Het
Kif12 G A 4: 63,169,525 probably benign Het
Lrp2 A T 2: 69,479,148 N2802K probably damaging Het
Mab21l2 C G 3: 86,546,989 G235R probably benign Het
Mapk8 T C 14: 33,382,208 E417G probably benign Het
Mapk8ip3 G A 17: 24,909,171 probably benign Het
Mettl1 A G 10: 127,045,077 T203A probably benign Het
Mettl9 T C 7: 121,076,313 V312A probably damaging Het
Mex3d A G 10: 80,386,894 V176A probably benign Het
Mmp3 T C 9: 7,449,790 S225P probably damaging Het
Mrvi1 G A 7: 110,876,897 P757S probably benign Het
Neb G A 2: 52,188,677 probably benign Het
Ninj2 C T 6: 120,198,051 A51V possibly damaging Het
Nle1 A G 11: 82,905,379 probably benign Het
Nol9 T C 4: 152,052,605 Y532H probably benign Het
Nr2c1 T A 10: 94,171,158 V286E probably benign Het
Olfr1183 T G 2: 88,461,925 L195R probably damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr308 T C 7: 86,321,292 Y220C probably benign Het
Olfr481 T A 7: 108,080,872 I26N possibly damaging Het
Olfr670 T A 7: 104,959,943 H263L probably damaging Het
Olfr816 A G 10: 129,911,916 Y121H probably benign Het
Olfr827 A G 10: 130,210,620 L170P probably damaging Het
Ovch2 A T 7: 107,801,136 V15D probably damaging Het
Pclo T G 5: 14,681,734 S3417A unknown Het
Pet2 C A X: 89,405,209 R438L probably benign Het
Pex1 T A 5: 3,633,759 M1085K probably damaging Het
Plscr2 T C 9: 92,282,135 S6P probably benign Het
Pogz C T 3: 94,877,025 P722S possibly damaging Het
Pom121l2 A T 13: 21,982,225 D222V probably benign Het
Prpf40a T C 2: 53,159,313 Y179C probably damaging Het
R3hdm2 A G 10: 127,458,173 I179V possibly damaging Het
Ranbp9 A C 13: 43,422,658 V355G probably damaging Het
Rims2 T C 15: 39,509,632 probably benign Het
Ryr2 A T 13: 11,705,684 S2693T probably benign Het
Sbno1 G A 5: 124,410,285 T111I probably damaging Het
Sdk1 A C 5: 142,046,161 N997T possibly damaging Het
Setx G T 2: 29,166,289 E39* probably null Het
Skint7 T A 4: 111,980,362 N112K probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 A T 2: 62,190,848 D80V probably benign Het
Susd2 C A 10: 75,638,603 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tdpoz3 T C 3: 93,826,365 Y116H probably benign Het
Tex26 C A 5: 149,460,858 D164E probably benign Het
Thoc5 G A 11: 4,902,213 probably benign Het
Tiparp A G 3: 65,531,436 R58G probably benign Het
Trim66 A T 7: 109,475,264 C597S probably damaging Het
Ugt2a3 T A 5: 87,336,490 Q225L probably benign Het
Vmn1r25 T A 6: 57,978,711 I198L probably benign Het
Vmn2r106 A T 17: 20,279,019 V210D possibly damaging Het
Vmn2r124 T C 17: 18,064,145 F483L probably damaging Het
Vmn2r78 A G 7: 86,921,311 K346E probably benign Het
Zfhx4 T A 3: 5,401,161 S2126R possibly damaging Het
Zfp608 C T 18: 54,898,994 G625R probably benign Het
Zkscan5 A G 5: 145,212,575 D234G probably damaging Het
Zscan10 T A 17: 23,605,915 V115E probably damaging Het
Other mutations in Tcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Tcf3 APN 10 80413209 missense probably benign 0.30
IGL02676:Tcf3 APN 10 80421091 missense probably damaging 1.00
IGL03066:Tcf3 APN 10 80413045 missense probably damaging 0.97
R0165:Tcf3 UTSW 10 80412997 missense probably damaging 1.00
R0624:Tcf3 UTSW 10 80413334 missense probably damaging 1.00
R2114:Tcf3 UTSW 10 80410206 missense probably damaging 1.00
R5034:Tcf3 UTSW 10 80417543 missense possibly damaging 0.46
R5144:Tcf3 UTSW 10 80415237 missense probably damaging 0.98
R5347:Tcf3 UTSW 10 80410211 missense probably damaging 1.00
R5418:Tcf3 UTSW 10 80427683 missense probably damaging 1.00
R5771:Tcf3 UTSW 10 80421616 intron probably benign
R5786:Tcf3 UTSW 10 80419499 missense probably benign 0.06
R5941:Tcf3 UTSW 10 80413044 missense probably benign 0.06
R6857:Tcf3 UTSW 10 80416899 intron probably null
R6982:Tcf3 UTSW 10 80417550 missense probably damaging 1.00
R7178:Tcf3 UTSW 10 80421599 missense unknown
X0022:Tcf3 UTSW 10 80417458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAACGAGCACCTCTCATGAC -3'
(R):5'- CAGCAGTGACCAGAACAGTTCTTCC -3'

Sequencing Primer
(F):5'- TAGCATCCGACTCACTGCC -3'
(R):5'- TTTGACCCTAGCCGGGTAAG -3'
Posted On2013-05-23