Incidental Mutation 'R4973:Neurl2'
ID382349
Institutional Source Beutler Lab
Gene Symbol Neurl2
Ensembl Gene ENSMUSG00000039873
Gene Nameneuralized E3 ubiquitin protein ligase 2
SynonymsOzz, Ozz-E3
MMRRC Submission 042568-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4973 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164830732-164833456 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 164833202 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017904] [ENSMUST00000017911] [ENSMUST00000042775] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000151493] [ENSMUST00000152721]
Predicted Effect probably null
Transcript: ENSMUST00000017904
SMART Domains Protein: ENSMUSP00000017904
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Peptidase_S10 52 489 2.5e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017911
SMART Domains Protein: ENSMUSP00000017911
Gene: ENSMUSG00000017767

DomainStartEndE-ValueType
Pfam:SPATA25 1 226 3.2e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042775
AA Change: H80L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873
AA Change: H80L

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103092
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103093
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127650
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect probably benign
Transcript: ENSMUST00000143780
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect probably null
Transcript: ENSMUST00000151493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Meta Mutation Damage Score 0.516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the regulation of myofibril organization. This protein is likely the adaptor component of the E3 ubiquitin ligase complex in striated muscle, and it regulates the ubiquitin-mediated degradation of beta-catenin during myogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display myofiber abnormalities in skeletal muscle and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Ankrd27 A G 7: 35,632,992 D848G probably benign Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atp2c2 A G 8: 119,754,263 T797A probably benign Het
Ccdc121 A T 1: 181,511,264 V41E possibly damaging Het
Ccdc122 A T 14: 77,067,941 I12F possibly damaging Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Cdk5r2 A G 1: 74,855,672 D192G probably damaging Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
Clock A G 5: 76,254,411 V134A possibly damaging Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Csf1r A T 18: 61,129,047 I792F probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D5Ertd579e A G 5: 36,672,905 V25A probably benign Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Ddx5 C A 11: 106,785,007 V286L possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dnhd1 T G 7: 105,713,633 L3801V probably benign Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Ercc6 A G 14: 32,574,902 D1283G probably damaging Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fanca G A 8: 123,308,522 T228M probably damaging Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo16 G T 14: 65,321,297 A302S probably benign Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm6327 T C 16: 12,760,981 noncoding transcript Het
Gnl3 A T 14: 31,013,505 N411K possibly damaging Het
Golga1 A T 2: 39,039,106 D308E probably damaging Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gsap A T 5: 21,254,039 T501S probably benign Het
Helq A G 5: 100,792,871 probably benign Het
Hmcn2 A G 2: 31,344,096 H291R probably benign Het
Htt A T 5: 34,813,023 D505V probably damaging Het
Ildr1 C T 16: 36,708,298 T35I probably benign Het
Iqgap2 A G 13: 95,657,797 probably null Het
Kansl1 C T 11: 104,424,321 R297H probably damaging Het
Kat2b-ps T C 5: 93,391,785 noncoding transcript Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kcnt2 A T 1: 140,609,650 S1116C probably damaging Het
Krt9 C T 11: 100,188,712 G618E unknown Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mdn1 A G 4: 32,734,418 D3275G probably benign Het
Mindy2 A T 9: 70,605,171 V599E possibly damaging Het
Nelfa A G 5: 33,901,818 V231A probably benign Het
Nepro T C 16: 44,734,793 Y411H probably benign Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Nkx1-1 G T 5: 33,431,066 Q293K possibly damaging Het
Nphp3 C T 9: 104,031,999 H803Y probably benign Het
Obscn A G 11: 59,132,466 V695A probably damaging Het
Olfr105-ps G A 17: 37,383,019 A151T probably damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr330 T C 11: 58,529,077 E303G probably benign Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Olfr926 A G 9: 38,878,104 *309W probably null Het
Orai3 T A 7: 127,774,176 L283Q probably damaging Het
Pcdhb13 A T 18: 37,443,184 D205V probably benign Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pgm3 A G 9: 86,562,679 S268P probably benign Het
Piezo2 A T 18: 63,074,680 I1420N probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Psmd13 T A 7: 140,886,853 Y117* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Pum1 T G 4: 130,669,137 S68A probably benign Het
Rnf167 T A 11: 70,649,875 probably benign Het
Rnf213 T C 11: 119,428,157 V1148A possibly damaging Het
Rnf216 T C 5: 143,090,316 E271G probably benign Het
Ros1 A T 10: 52,154,991 I506N probably damaging Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rpl41 A C 10: 128,548,707 probably benign Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Sacs G T 14: 61,213,122 A4206S probably damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc36a3 T C 11: 55,146,804 probably benign Het
Slc39a3 A T 10: 81,030,962 W317R probably damaging Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Snrpd1 T C 18: 10,626,835 V34A probably benign Het
Spire2 T A 8: 123,356,844 I189N probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Taar7b T A 10: 24,000,345 F136Y probably benign Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tcp11l2 A G 10: 84,591,163 I164V probably damaging Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Tns4 G T 11: 99,075,213 P448Q probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Usp45 A T 4: 21,815,372 T362S probably damaging Het
Vcan A T 13: 89,688,842 M2861K probably benign Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zbtb34 T A 2: 33,411,614 Q305L probably benign Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp804b A T 5: 6,771,198 S622T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Neurl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02274:Neurl2 APN 2 164833092 missense probably damaging 1.00
R1458:Neurl2 UTSW 2 164832746 missense possibly damaging 0.95
R2929:Neurl2 UTSW 2 164833344 missense possibly damaging 0.95
R3033:Neurl2 UTSW 2 164833055 missense probably benign 0.02
R4849:Neurl2 UTSW 2 164832819 unclassified probably null
R4959:Neurl2 UTSW 2 164833202 splice site probably null
R5360:Neurl2 UTSW 2 164833101 missense probably damaging 1.00
R5885:Neurl2 UTSW 2 164832891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAACCAGTAGGGCTTGG -3'
(R):5'- CTGCCCAAAATAGCCCTTGG -3'

Sequencing Primer
(F):5'- GTGATAGCGAAGACCCAA -3'
(R):5'- ATGAGCTGCCCTGTTGCAC -3'
Posted On2016-04-27