Incidental Mutation 'R4974:Map2'
ID382447
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66413505 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 360 (V360A)
Ref Sequence ENSEMBL: ENSMUSP00000134538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
AA Change: V518A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: V518A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
AA Change: V360A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222
AA Change: V360A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCTATCGAAGAAGCTGTGGC -3'
(R):5'- ACTCAGTGCTTCTCGTCATG -3'

Sequencing Primer
(F):5'- TTCTCCAAGGAAGACCAG -3'
(R):5'- GTCATGTCTTCTTTCAATGCAGATG -3'
Posted On2016-04-27