Incidental Mutation 'R4974:Aspm'
ID382450
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Nameabnormal spindle microtubule assembly
SynonymsAspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 042569-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139454772-139494091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139478010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1545 (V1545A)
Ref Sequence ENSEMBL: ENSMUSP00000059159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
Predicted Effect probably benign
Transcript: ENSMUST00000053364
AA Change: V1545A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: V1545A

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199998
Predicted Effect probably benign
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 intron probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 intron probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACATTACAGGGCACGTCAG -3'
(R):5'- AAATGCTTTTCTGGCTTGCATC -3'

Sequencing Primer
(F):5'- TTACAGGGCACGTCAGAAGGG -3'
(R):5'- GCATCCCTCTACATGCAGACTGTAG -3'
Posted On2016-04-27