Incidental Mutation 'R4975:Ccni'
ID382564
Institutional Source Beutler Lab
Gene Symbol Ccni
Ensembl Gene ENSMUSG00000063015
Gene Namecyclin I
Synonyms
MMRRC Submission 042570-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4975 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location93181933-93206495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93187694 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 195 (L195Q)
Ref Sequence ENSEMBL: ENSMUSP00000050189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058550] [ENSMUST00000144514] [ENSMUST00000151568] [ENSMUST00000201823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058550
AA Change: L195Q

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050189
Gene: ENSMUSG00000063015
AA Change: L195Q

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123033
Predicted Effect probably benign
Transcript: ENSMUST00000144514
SMART Domains Protein: ENSMUSP00000122434
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
Pfam:Cyclin_N 14 81 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151568
SMART Domains Protein: ENSMUSP00000116224
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201581
Predicted Effect probably benign
Transcript: ENSMUST00000201823
SMART Domains Protein: ENSMUSP00000143972
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 3 89 7.4e-19 SMART
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,518,736 V240A probably benign Het
Abcc8 T C 7: 46,150,867 K497R probably damaging Het
Aldh1a3 C T 7: 66,419,179 R19Q possibly damaging Het
Bmp2k A G 5: 97,087,085 probably benign Het
C130079G13Rik A C 3: 59,932,740 T78P probably damaging Het
Cdkl4 C A 17: 80,525,335 G327* probably null Het
Cdsn T C 17: 35,555,429 V285A possibly damaging Het
Chtf18 T C 17: 25,724,566 E352G possibly damaging Het
Clasp2 T A 9: 113,903,916 I961N probably damaging Het
Cpsf2 A G 12: 101,983,493 Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,526 Q1055H possibly damaging Het
Cyld T G 8: 88,707,232 F216L probably benign Het
Cyp3a41a A G 5: 145,720,048 M1T probably null Het
Disp3 C T 4: 148,244,216 R1097H possibly damaging Het
Dmap1 T C 4: 117,681,036 D67G possibly damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Ergic3 T C 2: 156,017,718 probably null Het
Fkbp14 A G 6: 54,592,958 I29T probably benign Het
Gm4845 T A 1: 141,256,885 noncoding transcript Het
Gm6614 T C 6: 141,980,873 S576G probably benign Het
Gm7135 A T 1: 97,354,076 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gtf2ird1 T A 5: 134,395,627 I57F probably damaging Het
Hectd1 A G 12: 51,762,497 V1722A probably benign Het
Hmcn2 A G 2: 31,393,025 D1971G possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Itih4 T A 14: 30,892,287 I398N probably damaging Het
Kansl1 A T 11: 104,335,564 S922R probably damaging Het
Krt27 G A 11: 99,346,896 Q339* probably null Het
Lama1 C A 17: 67,738,834 L245I possibly damaging Het
Lmo2 T A 2: 103,976,143 C60* probably null Het
Med16 A G 10: 79,903,005 S316P possibly damaging Het
Mia3 T C 1: 183,331,115 N529S probably benign Het
Msi2 T C 11: 88,394,655 K188E probably damaging Het
Myh7 T C 14: 54,971,671 K1870R probably damaging Het
Nhlrc1 A G 13: 47,013,740 V347A probably benign Het
Nol6 C T 4: 41,120,167 R487H probably benign Het
Olfr1222 T C 2: 89,125,338 Y131C probably damaging Het
Olfr1287 T C 2: 111,449,683 I181T probably benign Het
Olfr648 A T 7: 104,179,529 V293D probably damaging Het
Olfr73 T C 2: 88,034,661 I159M probably benign Het
Olfr775 T C 10: 129,251,272 I246T probably damaging Het
Otog T C 7: 46,287,991 V1708A probably benign Het
Ptprv A G 1: 135,118,848 noncoding transcript Het
Pus7l A G 15: 94,529,488 V471A possibly damaging Het
Rab11fip4 A G 11: 79,619,671 R68G probably damaging Het
Ralgapb A G 2: 158,435,508 D264G possibly damaging Het
Reln A G 5: 21,960,426 S2045P probably damaging Het
Rgs22 A C 15: 36,054,876 Y593* probably null Het
Ror2 C T 13: 53,131,918 D87N probably damaging Het
Rps6ka4 A T 19: 6,840,310 probably null Het
Rttn T A 18: 89,064,085 probably null Het
Runx3 A G 4: 135,171,135 T206A probably benign Het
Setx A G 2: 29,164,550 E2158G probably damaging Het
Siglece C T 7: 43,658,972 probably null Het
Snx1 A T 9: 66,104,905 L96* probably null Het
Srrm1 A G 4: 135,346,720 probably benign Het
Stk39 A T 2: 68,220,992 probably benign Het
Sun3 G A 11: 9,038,311 R4* probably null Het
Svil A G 18: 5,054,025 K347E possibly damaging Het
Sybu T A 15: 44,677,667 E333V probably damaging Het
Tet2 A G 3: 133,486,759 probably benign Het
Tfip11 G T 5: 112,335,747 probably benign Het
Tmc1 A C 19: 20,906,955 D40E probably damaging Het
Twf2 G T 9: 106,212,340 G121W probably damaging Het
Vpreb3 A G 10: 75,939,802 V50A probably damaging Het
Vps8 T A 16: 21,466,469 L400Q probably damaging Het
Xylt1 A T 7: 117,667,342 Y861F probably damaging Het
Zfp608 T G 18: 54,889,890 T1485P probably damaging Het
Zfp619 T G 7: 39,537,080 S845A possibly damaging Het
Zscan4d A T 7: 11,165,347 M1K probably null Het
Other mutations in Ccni
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02301:Ccni APN 5 93188175 missense possibly damaging 0.77
IGL02545:Ccni APN 5 93187777 missense probably benign 0.01
IGL02865:Ccni APN 5 93183336 missense probably benign 0.04
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0541:Ccni UTSW 5 93187704 missense probably benign 0.00
R0718:Ccni UTSW 5 93202316 missense probably benign 0.00
R0760:Ccni UTSW 5 93183329 missense possibly damaging 0.89
R1656:Ccni UTSW 5 93188074 splice site probably null
R1752:Ccni UTSW 5 93202456 start gained probably benign
R1817:Ccni UTSW 5 93188108 missense possibly damaging 0.89
R3551:Ccni UTSW 5 93187761 missense probably benign 0.05
R3552:Ccni UTSW 5 93187761 missense probably benign 0.05
R3956:Ccni UTSW 5 93183404 missense probably damaging 1.00
R4809:Ccni UTSW 5 93187570 intron probably benign
R4901:Ccni UTSW 5 93183144 missense probably damaging 1.00
R4937:Ccni UTSW 5 93188254 intron probably null
R7120:Ccni UTSW 5 93183331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCCTTCTCTATCATGAACTAAC -3'
(R):5'- ACTTGCATCGTACCTGAGATG -3'

Sequencing Primer
(F):5'- TCTATCATGAACTAACTCTCCCAC -3'
(R):5'- GCATCGTACCTGAGATGTTATTTC -3'
Posted On2016-04-27