Incidental Mutation 'R4975:Vps8'
ID382600
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene NameVPS8 CORVET complex subunit
Synonyms
MMRRC Submission 042570-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4975 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21423118-21644680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21466469 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 400 (L400Q)
Ref Sequence ENSEMBL: ENSMUSP00000112636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
Predicted Effect probably damaging
Transcript: ENSMUST00000096191
AA Change: L398Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: L398Q

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000096192
AA Change: L400Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: L400Q

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115397
AA Change: L400Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: L400Q

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117598
AA Change: L398Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: L398Q

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118923
AA Change: L400Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: L400Q

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125487
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,518,736 V240A probably benign Het
Abcc8 T C 7: 46,150,867 K497R probably damaging Het
Aldh1a3 C T 7: 66,419,179 R19Q possibly damaging Het
Bmp2k A G 5: 97,087,085 probably benign Het
C130079G13Rik A C 3: 59,932,740 T78P probably damaging Het
Ccni A T 5: 93,187,694 L195Q possibly damaging Het
Cdkl4 C A 17: 80,525,335 G327* probably null Het
Cdsn T C 17: 35,555,429 V285A possibly damaging Het
Chtf18 T C 17: 25,724,566 E352G possibly damaging Het
Clasp2 T A 9: 113,903,916 I961N probably damaging Het
Cpsf2 A G 12: 101,983,493 Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,526 Q1055H possibly damaging Het
Cyld T G 8: 88,707,232 F216L probably benign Het
Cyp3a41a A G 5: 145,720,048 M1T probably null Het
Disp3 C T 4: 148,244,216 R1097H possibly damaging Het
Dmap1 T C 4: 117,681,036 D67G possibly damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Ergic3 T C 2: 156,017,718 probably null Het
Fkbp14 A G 6: 54,592,958 I29T probably benign Het
Gm4845 T A 1: 141,256,885 noncoding transcript Het
Gm6614 T C 6: 141,980,873 S576G probably benign Het
Gm7135 A T 1: 97,354,076 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gtf2ird1 T A 5: 134,395,627 I57F probably damaging Het
Hectd1 A G 12: 51,762,497 V1722A probably benign Het
Hmcn2 A G 2: 31,393,025 D1971G possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Itih4 T A 14: 30,892,287 I398N probably damaging Het
Kansl1 A T 11: 104,335,564 S922R probably damaging Het
Krt27 G A 11: 99,346,896 Q339* probably null Het
Lama1 C A 17: 67,738,834 L245I possibly damaging Het
Lmo2 T A 2: 103,976,143 C60* probably null Het
Med16 A G 10: 79,903,005 S316P possibly damaging Het
Mia3 T C 1: 183,331,115 N529S probably benign Het
Msi2 T C 11: 88,394,655 K188E probably damaging Het
Myh7 T C 14: 54,971,671 K1870R probably damaging Het
Nhlrc1 A G 13: 47,013,740 V347A probably benign Het
Nol6 C T 4: 41,120,167 R487H probably benign Het
Olfr1222 T C 2: 89,125,338 Y131C probably damaging Het
Olfr1287 T C 2: 111,449,683 I181T probably benign Het
Olfr648 A T 7: 104,179,529 V293D probably damaging Het
Olfr73 T C 2: 88,034,661 I159M probably benign Het
Olfr775 T C 10: 129,251,272 I246T probably damaging Het
Otog T C 7: 46,287,991 V1708A probably benign Het
Ptprv A G 1: 135,118,848 noncoding transcript Het
Pus7l A G 15: 94,529,488 V471A possibly damaging Het
Rab11fip4 A G 11: 79,619,671 R68G probably damaging Het
Ralgapb A G 2: 158,435,508 D264G possibly damaging Het
Reln A G 5: 21,960,426 S2045P probably damaging Het
Rgs22 A C 15: 36,054,876 Y593* probably null Het
Ror2 C T 13: 53,131,918 D87N probably damaging Het
Rps6ka4 A T 19: 6,840,310 probably null Het
Rttn T A 18: 89,064,085 probably null Het
Runx3 A G 4: 135,171,135 T206A probably benign Het
Setx A G 2: 29,164,550 E2158G probably damaging Het
Siglece C T 7: 43,658,972 probably null Het
Snx1 A T 9: 66,104,905 L96* probably null Het
Srrm1 A G 4: 135,346,720 probably benign Het
Stk39 A T 2: 68,220,992 probably benign Het
Sun3 G A 11: 9,038,311 R4* probably null Het
Svil A G 18: 5,054,025 K347E possibly damaging Het
Sybu T A 15: 44,677,667 E333V probably damaging Het
Tet2 A G 3: 133,486,759 probably benign Het
Tfip11 G T 5: 112,335,747 probably benign Het
Tmc1 A C 19: 20,906,955 D40E probably damaging Het
Twf2 G T 9: 106,212,340 G121W probably damaging Het
Vpreb3 A G 10: 75,939,802 V50A probably damaging Het
Xylt1 A T 7: 117,667,342 Y861F probably damaging Het
Zfp608 T G 18: 54,889,890 T1485P probably damaging Het
Zfp619 T G 7: 39,537,080 S845A possibly damaging Het
Zscan4d A T 7: 11,165,347 M1K probably null Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 unclassified probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21470154 missense probably benign 0.00
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0605:Vps8 UTSW 16 21559337 missense probably benign 0.00
R0636:Vps8 UTSW 16 21434933 missense probably benign 0.32
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R3944:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 unclassified probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 unclassified probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R5963:Vps8 UTSW 16 21470121 missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
R7195:Vps8 UTSW 16 21456282 missense probably damaging 1.00
R7206:Vps8 UTSW 16 21457421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCTGTTCACCTATGCAATAG -3'
(R):5'- TTCAGCAGGACTTTGGGCAAC -3'

Sequencing Primer
(F):5'- GCTGTTCACCTATGCAATAGTTTCTC -3'
(R):5'- ACTTTGGGCAACTGGGC -3'
Posted On2016-04-27