Incidental Mutation 'R4976:Dock10'
ID382615
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 042571-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4976 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 80567994 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably null
Transcript: ENSMUST00000077946
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187774
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190595
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190983
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,184 probably null Het
4930486L24Rik A T 13: 60,853,573 Y113* probably null Het
Abcc2 C T 19: 43,800,635 T243M probably benign Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts2 A G 11: 50,737,366 I298V possibly damaging Het
Adamts6 T A 13: 104,297,490 S142R probably damaging Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Alg6 G A 4: 99,750,728 probably null Het
Aoc3 T A 11: 101,330,974 L12Q probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Atp2b2 T A 6: 113,759,161 I986F probably damaging Het
Axin1 A T 17: 26,194,070 Q779L probably benign Het
Axin1 G T 17: 26,194,071 Q779H probably benign Het
Btaf1 T C 19: 36,986,579 V850A probably benign Het
Camsap2 A G 1: 136,304,386 V157A probably damaging Het
Ccdc191 T C 16: 43,943,505 V443A probably benign Het
Cd1d1 T A 3: 86,998,651 M106L probably benign Het
Cenpe A G 3: 135,234,876 D632G probably damaging Het
Cnih2 T A 19: 5,093,929 probably null Het
Crnkl1 G T 2: 145,923,876 Q425K possibly damaging Het
Crnn T A 3: 93,148,683 S259T probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 G T 11: 69,027,326 G425C probably damaging Het
Dctn4 T A 18: 60,556,392 I445N probably benign Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dst A T 1: 34,195,969 K3710* probably null Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Elp6 C T 9: 110,314,073 P118L probably damaging Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Ep400 A G 5: 110,698,812 F1480L unknown Het
Ep400 T C 5: 110,720,756 E934G unknown Het
Epb41 A C 4: 131,937,436 probably benign Het
Epha5 A T 5: 84,084,824 V777E probably damaging Het
Erp44 A T 4: 48,208,797 M221K probably benign Het
Esp36 T C 17: 38,417,286 T35A possibly damaging Het
Flvcr1 T C 1: 191,025,495 Q158R probably damaging Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Fzd10 T A 5: 128,602,114 Y299* probably null Het
Gabrg1 C A 5: 70,774,411 V330L possibly damaging Het
Gata4 A T 14: 63,203,689 N87K probably damaging Het
Gdpd3 A T 7: 126,767,282 N97I probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm38394 T C 1: 133,658,094 T502A probably benign Het
Golim4 T C 3: 75,878,643 probably null Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Hsd17b4 T C 18: 50,160,135 L247S probably damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Igkv17-121 A G 6: 68,037,084 K40R probably benign Het
Igsf3 T A 3: 101,439,361 probably null Het
Ints1 C A 5: 139,752,811 G110C probably damaging Het
Klhdc8b A T 9: 108,451,187 V22E probably damaging Het
Kmt2d G A 15: 98,847,194 probably benign Het
Kpna2 C T 11: 106,991,469 G204S probably damaging Het
Ktn1 G A 14: 47,670,299 probably null Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lmx1a G T 1: 167,791,554 A161S possibly damaging Het
Lrig1 T C 6: 94,625,062 Y270C probably damaging Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Ltbp1 T C 17: 75,321,095 probably null Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Meltf T C 16: 31,894,714 S592P probably benign Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrpl39 A G 16: 84,734,405 probably null Het
Myocd T C 11: 65,222,050 T79A probably benign Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Ncoa3 T A 2: 166,047,900 D68E probably damaging Het
Nt5m T A 11: 59,874,555 Y136* probably null Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1564 C T 17: 33,215,754 A200T probably benign Het
Olfr490 A C 7: 108,286,611 C172G probably damaging Het
Olfr631 A T 7: 103,929,737 I305F probably benign Het
Olfr836 G A 9: 19,121,501 C179Y probably damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcyox1 T A 6: 86,388,726 K502M probably damaging Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Ppp2r2a A T 14: 67,016,637 S361T possibly damaging Het
Prim1 A T 10: 128,015,262 D5V probably damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Retsat T A 6: 72,601,626 M107K probably damaging Het
Rhbdl1 C T 17: 25,835,028 W289* probably null Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rprd2 T A 3: 95,766,349 T497S probably damaging Het
Rps6kc1 T C 1: 190,798,727 T936A probably damaging Het
Scgb1b10 A G 7: 32,101,184 Q66R possibly damaging Het
Scrib C T 15: 76,051,753 probably null Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Shox2 T C 3: 66,973,675 probably benign Het
Skp1a C A 11: 52,243,631 T63N probably benign Het
Slc10a6 C T 5: 103,606,604 V354M probably benign Het
Slc35f3 T C 8: 126,389,281 probably null Het
Slc8b1 T A 5: 120,525,675 L320* probably null Het
Snap29 T A 16: 17,419,268 L81Q probably damaging Het
Sorl1 A G 9: 41,983,003 I1837T probably benign Het
Tacr3 A G 3: 134,932,272 T397A probably benign Het
Tcte1 T C 17: 45,534,928 F153L probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tmprss4 A G 9: 45,173,408 S433P possibly damaging Het
Tpcn1 T C 5: 120,560,322 H45R probably benign Het
Uhrf1bp1 T C 17: 27,884,026 S345P probably damaging Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAAATTGTCCTGGCAAG -3'
(R):5'- AGCAGTAATGGCTCAGAACATC -3'

Sequencing Primer
(F):5'- AAGGGCATGGCATCCTGTG -3'
(R):5'- GTAATGGCTCAGAACATCAAATTAAC -3'
Posted On2016-04-27