Incidental Mutation 'R4976:Gm28042'
ID382628
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Namepredicted gene, 28042
Synonyms
MMRRC Submission 042571-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R4976 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120027493-120043033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120034643 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 250 (A250T)
Ref Sequence ENSEMBL: ENSMUSP00000117535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000126150] [ENSMUST00000129679] [ENSMUST00000129685] [ENSMUST00000135365] [ENSMUST00000156805] [ENSMUST00000162393]
Predicted Effect probably benign
Transcript: ENSMUST00000044675
SMART Domains Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 307 4.31e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125805
SMART Domains Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
Pfam:Cupin_8 2 62 2.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126150
AA Change: A27T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: A27T

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129679
Predicted Effect probably damaging
Transcript: ENSMUST00000129685
AA Change: A250T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: A250T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect probably benign
Transcript: ENSMUST00000135365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153571
Predicted Effect probably damaging
Transcript: ENSMUST00000156805
AA Change: A250T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: A250T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,184 probably null Het
4930486L24Rik A T 13: 60,853,573 Y113* probably null Het
Abcc2 C T 19: 43,800,635 T243M probably benign Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts2 A G 11: 50,737,366 I298V possibly damaging Het
Adamts6 T A 13: 104,297,490 S142R probably damaging Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Alg6 G A 4: 99,750,728 probably null Het
Aoc3 T A 11: 101,330,974 L12Q probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Atp2b2 T A 6: 113,759,161 I986F probably damaging Het
Axin1 A T 17: 26,194,070 Q779L probably benign Het
Axin1 G T 17: 26,194,071 Q779H probably benign Het
Btaf1 T C 19: 36,986,579 V850A probably benign Het
Camsap2 A G 1: 136,304,386 V157A probably damaging Het
Ccdc191 T C 16: 43,943,505 V443A probably benign Het
Cd1d1 T A 3: 86,998,651 M106L probably benign Het
Cenpe A G 3: 135,234,876 D632G probably damaging Het
Cnih2 T A 19: 5,093,929 probably null Het
Crnkl1 G T 2: 145,923,876 Q425K possibly damaging Het
Crnn T A 3: 93,148,683 S259T probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 G T 11: 69,027,326 G425C probably damaging Het
Dctn4 T A 18: 60,556,392 I445N probably benign Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Elp6 C T 9: 110,314,073 P118L probably damaging Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Ep400 A G 5: 110,698,812 F1480L unknown Het
Ep400 T C 5: 110,720,756 E934G unknown Het
Epb41 A C 4: 131,937,436 probably benign Het
Epha5 A T 5: 84,084,824 V777E probably damaging Het
Erp44 A T 4: 48,208,797 M221K probably benign Het
Esp36 T C 17: 38,417,286 T35A possibly damaging Het
Flvcr1 T C 1: 191,025,495 Q158R probably damaging Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Fzd10 T A 5: 128,602,114 Y299* probably null Het
Gabrg1 C A 5: 70,774,411 V330L possibly damaging Het
Gata4 A T 14: 63,203,689 N87K probably damaging Het
Gdpd3 A T 7: 126,767,282 N97I probably damaging Het
Gm38394 T C 1: 133,658,094 T502A probably benign Het
Golim4 T C 3: 75,878,643 probably null Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Hsd17b4 T C 18: 50,160,135 L247S probably damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Igkv17-121 A G 6: 68,037,084 K40R probably benign Het
Igsf3 T A 3: 101,439,361 probably null Het
Ints1 C A 5: 139,752,811 G110C probably damaging Het
Klhdc8b A T 9: 108,451,187 V22E probably damaging Het
Kmt2d G A 15: 98,847,194 probably benign Het
Kpna2 C T 11: 106,991,469 G204S probably damaging Het
Ktn1 G A 14: 47,670,299 probably null Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lmx1a G T 1: 167,791,554 A161S possibly damaging Het
Lrig1 T C 6: 94,625,062 Y270C probably damaging Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Ltbp1 T C 17: 75,321,095 probably null Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Meltf T C 16: 31,894,714 S592P probably benign Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrpl39 A G 16: 84,734,405 probably null Het
Myocd T C 11: 65,222,050 T79A probably benign Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Ncoa3 T A 2: 166,047,900 D68E probably damaging Het
Nt5m T A 11: 59,874,555 Y136* probably null Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1564 C T 17: 33,215,754 A200T probably benign Het
Olfr490 A C 7: 108,286,611 C172G probably damaging Het
Olfr631 A T 7: 103,929,737 I305F probably benign Het
Olfr836 G A 9: 19,121,501 C179Y probably damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcyox1 T A 6: 86,388,726 K502M probably damaging Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Ppp2r2a A T 14: 67,016,637 S361T possibly damaging Het
Prim1 A T 10: 128,015,262 D5V probably damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Retsat T A 6: 72,601,626 M107K probably damaging Het
Rhbdl1 C T 17: 25,835,028 W289* probably null Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rprd2 T A 3: 95,766,349 T497S probably damaging Het
Rps6kc1 T C 1: 190,798,727 T936A probably damaging Het
Scgb1b10 A G 7: 32,101,184 Q66R possibly damaging Het
Scrib C T 15: 76,051,753 probably null Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Shox2 T C 3: 66,973,675 probably benign Het
Skp1a C A 11: 52,243,631 T63N probably benign Het
Slc10a6 C T 5: 103,606,604 V354M probably benign Het
Slc35f3 T C 8: 126,389,281 probably null Het
Slc8b1 T A 5: 120,525,675 L320* probably null Het
Snap29 T A 16: 17,419,268 L81Q probably damaging Het
Sorl1 A G 9: 41,983,003 I1837T probably benign Het
Tacr3 A G 3: 134,932,272 T397A probably benign Het
Tcte1 T C 17: 45,534,928 F153L probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tmprss4 A G 9: 45,173,408 S433P possibly damaging Het
Tpcn1 T C 5: 120,560,322 H45R probably benign Het
Uhrf1bp1 T C 17: 27,884,026 S345P probably damaging Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 120030356 missense probably damaging 1.00
IGL01148:Gm28042 APN 2 120039038 missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 120034634 missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 120039899 missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 120035221 missense probably damaging 1.00
IGL02747:Gm28042 APN 2 120031394 missense probably damaging 1.00
IGL02825:Gm28042 APN 2 120031644 missense probably damaging 0.99
IGL02998:Gm28042 APN 2 120040154 missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 120032156 missense probably damaging 1.00
IGL03084:Gm28042 APN 2 120040505 missense probably benign 0.08
IGL03160:Gm28042 APN 2 120035828 missense possibly damaging 0.94
PIT4520001:Gm28042 UTSW 2 120039667 nonsense probably null
R0147:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R0270:Gm28042 UTSW 2 120041592 missense probably benign 0.06
R0315:Gm28042 UTSW 2 120039057 missense probably damaging 1.00
R1421:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1589:Gm28042 UTSW 2 120041406 missense probably benign 0.05
R1599:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1656:Gm28042 UTSW 2 120038889 missense probably damaging 1.00
R1718:Gm28042 UTSW 2 120036391 missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 120041615 makesense probably null
R2164:Gm28042 UTSW 2 120036748 missense probably benign 0.01
R2275:Gm28042 UTSW 2 120036829 missense probably damaging 1.00
R3976:Gm28042 UTSW 2 120036756 missense probably benign 0.11
R4483:Gm28042 UTSW 2 120035840 missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 120041158 missense probably damaging 0.99
R4802:Gm28042 UTSW 2 120042054 utr 3 prime probably benign
R5119:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5177:Gm28042 UTSW 2 120041601 unclassified probably null
R5340:Gm28042 UTSW 2 120041448 missense probably benign
R5861:Gm28042 UTSW 2 120034635 missense probably damaging 1.00
R6641:Gm28042 UTSW 2 120039683 missense probably damaging 1.00
R7187:Gm28042 UTSW 2 120039695 missense probably damaging 1.00
X0019:Gm28042 UTSW 2 120039658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGATGGCTACAGGTGGAC -3'
(R):5'- GAAATTTCCCAGGCTGCCAG -3'

Sequencing Primer
(F):5'- CCTGGTCCTTTTGGTAGAGAATTAAG -3'
(R):5'- TCCATAGGACTGAGCCCTCTG -3'
Posted On2016-04-27