Incidental Mutation 'R4976:Igsf3'
ID382637
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Nameimmunoglobulin superfamily, member 3
Synonyms1700016K10Rik, 4833439O17Rik, 2810035F16Rik
MMRRC Submission 042571-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R4976 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location101377083-101463059 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 101439361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
Predicted Effect probably null
Transcript: ENSMUST00000043983
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195164
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Meta Mutation Damage Score 0.6368 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,184 probably null Het
4930486L24Rik A T 13: 60,853,573 Y113* probably null Het
Abcc2 C T 19: 43,800,635 T243M probably benign Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts2 A G 11: 50,737,366 I298V possibly damaging Het
Adamts6 T A 13: 104,297,490 S142R probably damaging Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Alg6 G A 4: 99,750,728 probably null Het
Aoc3 T A 11: 101,330,974 L12Q probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Atp2b2 T A 6: 113,759,161 I986F probably damaging Het
Axin1 A T 17: 26,194,070 Q779L probably benign Het
Axin1 G T 17: 26,194,071 Q779H probably benign Het
Btaf1 T C 19: 36,986,579 V850A probably benign Het
Camsap2 A G 1: 136,304,386 V157A probably damaging Het
Ccdc191 T C 16: 43,943,505 V443A probably benign Het
Cd1d1 T A 3: 86,998,651 M106L probably benign Het
Cenpe A G 3: 135,234,876 D632G probably damaging Het
Cnih2 T A 19: 5,093,929 probably null Het
Crnkl1 G T 2: 145,923,876 Q425K possibly damaging Het
Crnn T A 3: 93,148,683 S259T probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 G T 11: 69,027,326 G425C probably damaging Het
Dctn4 T A 18: 60,556,392 I445N probably benign Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Elp6 C T 9: 110,314,073 P118L probably damaging Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Ep400 A G 5: 110,698,812 F1480L unknown Het
Ep400 T C 5: 110,720,756 E934G unknown Het
Epb41 A C 4: 131,937,436 probably benign Het
Epha5 A T 5: 84,084,824 V777E probably damaging Het
Erp44 A T 4: 48,208,797 M221K probably benign Het
Esp36 T C 17: 38,417,286 T35A possibly damaging Het
Flvcr1 T C 1: 191,025,495 Q158R probably damaging Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Fzd10 T A 5: 128,602,114 Y299* probably null Het
Gabrg1 C A 5: 70,774,411 V330L possibly damaging Het
Gata4 A T 14: 63,203,689 N87K probably damaging Het
Gdpd3 A T 7: 126,767,282 N97I probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm38394 T C 1: 133,658,094 T502A probably benign Het
Golim4 T C 3: 75,878,643 probably null Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Hsd17b4 T C 18: 50,160,135 L247S probably damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Igkv17-121 A G 6: 68,037,084 K40R probably benign Het
Ints1 C A 5: 139,752,811 G110C probably damaging Het
Klhdc8b A T 9: 108,451,187 V22E probably damaging Het
Kmt2d G A 15: 98,847,194 probably benign Het
Kpna2 C T 11: 106,991,469 G204S probably damaging Het
Ktn1 G A 14: 47,670,299 probably null Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lmx1a G T 1: 167,791,554 A161S possibly damaging Het
Lrig1 T C 6: 94,625,062 Y270C probably damaging Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Ltbp1 T C 17: 75,321,095 probably null Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Meltf T C 16: 31,894,714 S592P probably benign Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrpl39 A G 16: 84,734,405 probably null Het
Myocd T C 11: 65,222,050 T79A probably benign Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Ncoa3 T A 2: 166,047,900 D68E probably damaging Het
Nt5m T A 11: 59,874,555 Y136* probably null Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1564 C T 17: 33,215,754 A200T probably benign Het
Olfr490 A C 7: 108,286,611 C172G probably damaging Het
Olfr631 A T 7: 103,929,737 I305F probably benign Het
Olfr836 G A 9: 19,121,501 C179Y probably damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcyox1 T A 6: 86,388,726 K502M probably damaging Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Ppp2r2a A T 14: 67,016,637 S361T possibly damaging Het
Prim1 A T 10: 128,015,262 D5V probably damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Retsat T A 6: 72,601,626 M107K probably damaging Het
Rhbdl1 C T 17: 25,835,028 W289* probably null Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rprd2 T A 3: 95,766,349 T497S probably damaging Het
Rps6kc1 T C 1: 190,798,727 T936A probably damaging Het
Scgb1b10 A G 7: 32,101,184 Q66R possibly damaging Het
Scrib C T 15: 76,051,753 probably null Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Shox2 T C 3: 66,973,675 probably benign Het
Skp1a C A 11: 52,243,631 T63N probably benign Het
Slc10a6 C T 5: 103,606,604 V354M probably benign Het
Slc35f3 T C 8: 126,389,281 probably null Het
Slc8b1 T A 5: 120,525,675 L320* probably null Het
Snap29 T A 16: 17,419,268 L81Q probably damaging Het
Sorl1 A G 9: 41,983,003 I1837T probably benign Het
Tacr3 A G 3: 134,932,272 T397A probably benign Het
Tcte1 T C 17: 45,534,928 F153L probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tmprss4 A G 9: 45,173,408 S433P possibly damaging Het
Tpcn1 T C 5: 120,560,322 H45R probably benign Het
Uhrf1bp1 T C 17: 27,884,026 S345P probably damaging Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101431239 missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101427448 splice site probably benign
IGL01321:Igsf3 APN 3 101427022 splice site probably benign
IGL01340:Igsf3 APN 3 101439679 nonsense probably null
IGL02291:Igsf3 APN 3 101439529 missense probably damaging 1.00
R0090:Igsf3 UTSW 3 101435652 missense probably damaging 1.00
R0143:Igsf3 UTSW 3 101435601 missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101435435 missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101427393 missense probably benign 0.31
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1384:Igsf3 UTSW 3 101451296 critical splice donor site probably null
R1594:Igsf3 UTSW 3 101451077 nonsense probably null
R1624:Igsf3 UTSW 3 101455227 missense probably benign 0.37
R1766:Igsf3 UTSW 3 101431282 missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101431296 missense probably benign 0.03
R2072:Igsf3 UTSW 3 101439515 missense probably benign 0.02
R4707:Igsf3 UTSW 3 101458094 missense probably benign 0.06
R4982:Igsf3 UTSW 3 101435667 missense probably benign 0.42
R5008:Igsf3 UTSW 3 101450917 missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101439361 splice site probably null
R5189:Igsf3 UTSW 3 101431527 missense possibly damaging 0.64
R5456:Igsf3 UTSW 3 101427221 missense probably benign 0.20
R5776:Igsf3 UTSW 3 101425480 missense probably benign 0.01
R6112:Igsf3 UTSW 3 101451006 missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101435648 missense probably benign 0.05
R6758:Igsf3 UTSW 3 101425498 missense probably damaging 0.98
X0027:Igsf3 UTSW 3 101435645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGTGAAGTCTTAGGAACTG -3'
(R):5'- GGAAAGTGGATGACTTGTCCC -3'

Sequencing Primer
(F):5'- CCGTGAAGTCTTAGGAACTGTTGTG -3'
(R):5'- GAACCCCTCCATCTCGTGTGAAG -3'
Posted On2016-04-27