Incidental Mutation 'R4976:Ep400'
ID382652
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
MMRRC Submission 042571-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4976 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110698812 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1480 (F1480L)
Ref Sequence ENSEMBL: ENSMUSP00000108055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: F1516L
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: F1516L

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: F1553L
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: F1553L

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: F1480L
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: F1480L

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125325
AA Change: F296L
SMART Domains Protein: ENSMUSP00000116137
Gene: ENSMUSG00000029505
AA Change: F296L

DomainStartEndE-ValueType
low complexity region 107 117 N/A INTRINSIC
low complexity region 223 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141986
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,184 probably null Het
4930486L24Rik A T 13: 60,853,573 Y113* probably null Het
Abcc2 C T 19: 43,800,635 T243M probably benign Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts2 A G 11: 50,737,366 I298V possibly damaging Het
Adamts6 T A 13: 104,297,490 S142R probably damaging Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Alg6 G A 4: 99,750,728 probably null Het
Aoc3 T A 11: 101,330,974 L12Q probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Atp2b2 T A 6: 113,759,161 I986F probably damaging Het
Axin1 A T 17: 26,194,070 Q779L probably benign Het
Axin1 G T 17: 26,194,071 Q779H probably benign Het
Btaf1 T C 19: 36,986,579 V850A probably benign Het
Camsap2 A G 1: 136,304,386 V157A probably damaging Het
Ccdc191 T C 16: 43,943,505 V443A probably benign Het
Cd1d1 T A 3: 86,998,651 M106L probably benign Het
Cenpe A G 3: 135,234,876 D632G probably damaging Het
Cnih2 T A 19: 5,093,929 probably null Het
Crnkl1 G T 2: 145,923,876 Q425K possibly damaging Het
Crnn T A 3: 93,148,683 S259T probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 G T 11: 69,027,326 G425C probably damaging Het
Dctn4 T A 18: 60,556,392 I445N probably benign Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Elp6 C T 9: 110,314,073 P118L probably damaging Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Epb41 A C 4: 131,937,436 probably benign Het
Epha5 A T 5: 84,084,824 V777E probably damaging Het
Erp44 A T 4: 48,208,797 M221K probably benign Het
Esp36 T C 17: 38,417,286 T35A possibly damaging Het
Flvcr1 T C 1: 191,025,495 Q158R probably damaging Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Fzd10 T A 5: 128,602,114 Y299* probably null Het
Gabrg1 C A 5: 70,774,411 V330L possibly damaging Het
Gata4 A T 14: 63,203,689 N87K probably damaging Het
Gdpd3 A T 7: 126,767,282 N97I probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm38394 T C 1: 133,658,094 T502A probably benign Het
Golim4 T C 3: 75,878,643 probably null Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Hsd17b4 T C 18: 50,160,135 L247S probably damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Igkv17-121 A G 6: 68,037,084 K40R probably benign Het
Igsf3 T A 3: 101,439,361 probably null Het
Ints1 C A 5: 139,752,811 G110C probably damaging Het
Klhdc8b A T 9: 108,451,187 V22E probably damaging Het
Kmt2d G A 15: 98,847,194 probably benign Het
Kpna2 C T 11: 106,991,469 G204S probably damaging Het
Ktn1 G A 14: 47,670,299 probably null Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lmx1a G T 1: 167,791,554 A161S possibly damaging Het
Lrig1 T C 6: 94,625,062 Y270C probably damaging Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Ltbp1 T C 17: 75,321,095 probably null Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Meltf T C 16: 31,894,714 S592P probably benign Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrpl39 A G 16: 84,734,405 probably null Het
Myocd T C 11: 65,222,050 T79A probably benign Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Ncoa3 T A 2: 166,047,900 D68E probably damaging Het
Nt5m T A 11: 59,874,555 Y136* probably null Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1564 C T 17: 33,215,754 A200T probably benign Het
Olfr490 A C 7: 108,286,611 C172G probably damaging Het
Olfr631 A T 7: 103,929,737 I305F probably benign Het
Olfr836 G A 9: 19,121,501 C179Y probably damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcyox1 T A 6: 86,388,726 K502M probably damaging Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Ppp2r2a A T 14: 67,016,637 S361T possibly damaging Het
Prim1 A T 10: 128,015,262 D5V probably damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Retsat T A 6: 72,601,626 M107K probably damaging Het
Rhbdl1 C T 17: 25,835,028 W289* probably null Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rprd2 T A 3: 95,766,349 T497S probably damaging Het
Rps6kc1 T C 1: 190,798,727 T936A probably damaging Het
Scgb1b10 A G 7: 32,101,184 Q66R possibly damaging Het
Scrib C T 15: 76,051,753 probably null Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Shox2 T C 3: 66,973,675 probably benign Het
Skp1a C A 11: 52,243,631 T63N probably benign Het
Slc10a6 C T 5: 103,606,604 V354M probably benign Het
Slc35f3 T C 8: 126,389,281 probably null Het
Slc8b1 T A 5: 120,525,675 L320* probably null Het
Snap29 T A 16: 17,419,268 L81Q probably damaging Het
Sorl1 A G 9: 41,983,003 I1837T probably benign Het
Tacr3 A G 3: 134,932,272 T397A probably benign Het
Tcte1 T C 17: 45,534,928 F153L probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tmprss4 A G 9: 45,173,408 S433P possibly damaging Het
Tpcn1 T C 5: 120,560,322 H45R probably benign Het
Uhrf1bp1 T C 17: 27,884,026 S345P probably damaging Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGTCAAGACAACTCATGAATGTC -3'
(R):5'- AGGCCTTATTTGTGGTCAGTAAC -3'

Sequencing Primer
(F):5'- TCATGCCTGGAGGAAGACC -3'
(R):5'- GTGGTCAGTAACTTCATTCCAAGTG -3'
Posted On2016-04-27