Incidental Mutation 'R4977:Tmeff2'
ID382726
Institutional Source Beutler Lab
Gene Symbol Tmeff2
Ensembl Gene ENSMUSG00000026109
Gene Nametransmembrane protein with EGF-like and two follistatin-like domains 2
Synonyms4832418D20Rik, 7630402F16Rik
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location50900647-51187270 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50979556 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 232 (C232*)
Ref Sequence ENSEMBL: ENSMUSP00000110212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081851] [ENSMUST00000114565]
Predicted Effect probably benign
Transcript: ENSMUST00000081851
SMART Domains Protein: ENSMUSP00000080533
Gene: ENSMUSG00000026109

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
KAZAL 181 227 6.05e-13 SMART
EGF 264 301 3.57e-2 SMART
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114565
AA Change: C232*
SMART Domains Protein: ENSMUSP00000110212
Gene: ENSMUSG00000026109
AA Change: C232*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele display slow postnatal weight gain, decreased white adipose tissue amount, and complete lethality at weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Tmeff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Tmeff2 APN 1 51185450 missense probably damaging 1.00
IGL00707:Tmeff2 APN 1 51133053 splice site probably null
IGL01096:Tmeff2 APN 1 50930546 splice site probably benign
IGL01897:Tmeff2 APN 1 51132210 missense probably damaging 1.00
IGL02797:Tmeff2 APN 1 50928047 missense probably damaging 1.00
IGL03245:Tmeff2 APN 1 51181817 missense probably benign 0.30
R0454:Tmeff2 UTSW 1 50928075 missense possibly damaging 0.92
R0975:Tmeff2 UTSW 1 50938205 splice site probably benign
R1161:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1310:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1457:Tmeff2 UTSW 1 51181867 missense probably damaging 1.00
R3001:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3002:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3424:Tmeff2 UTSW 1 50979617 intron probably benign
R4807:Tmeff2 UTSW 1 50979387 missense probably benign 0.01
R4923:Tmeff2 UTSW 1 50930645 missense probably benign 0.29
R5176:Tmeff2 UTSW 1 51071541 nonsense probably null
R5220:Tmeff2 UTSW 1 50979317 missense probably benign 0.01
R5919:Tmeff2 UTSW 1 51132152 nonsense probably null
R5990:Tmeff2 UTSW 1 50979442 nonsense probably null
R6353:Tmeff2 UTSW 1 51181826 missense probably damaging 1.00
R6358:Tmeff2 UTSW 1 51133114 nonsense probably null
R6925:Tmeff2 UTSW 1 50928021 missense probably damaging 0.99
R7163:Tmeff2 UTSW 1 50938344 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATCATCTTTAGAAGAGACCAACTC -3'
(R):5'- TATTCCACAGCAGGACACAG -3'

Sequencing Primer
(F):5'- AATGCGAACCTGACATGC -3'
(R):5'- CAGGACACAGAATAGCAATATCTTG -3'
Posted On2016-04-27