Incidental Mutation 'R4977:C1s2'
ID382751
Institutional Source Beutler Lab
Gene Symbol C1s2
Ensembl Gene ENSMUSG00000079343
Gene Namecomplement component 1, s subcomponent 2
SynonymsGm5077
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124624625-124636085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124635639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 19 (M19T)
Ref Sequence ENSEMBL: ENSMUSP00000066999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068797] [ENSMUST00000218020]
Predicted Effect probably damaging
Transcript: ENSMUST00000068797
AA Change: M19T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066999
Gene: ENSMUSG00000079343
AA Change: M19T

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204754
AA Change: M25T
SMART Domains Protein: ENSMUSP00000145029
Gene: ENSMUSG00000107554
AA Change: M25T

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218020
AA Change: M25T

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in C1s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:C1s2 APN 6 124625653 missense probably damaging 0.99
IGL02112:C1s2 APN 6 124625308 missense probably benign 0.28
IGL02342:C1s2 APN 6 124632116 missense probably damaging 0.98
R0616:C1s2 UTSW 6 124628764 missense probably damaging 1.00
R0621:C1s2 UTSW 6 124631112 missense probably damaging 1.00
R1439:C1s2 UTSW 6 124630167 splice site probably benign
R1451:C1s2 UTSW 6 124625494 missense probably benign 0.06
R1484:C1s2 UTSW 6 124625645 missense possibly damaging 0.95
R1570:C1s2 UTSW 6 124625764 missense probably benign 0.01
R1824:C1s2 UTSW 6 124635682 missense probably benign 0.03
R2009:C1s2 UTSW 6 124635089 missense probably damaging 1.00
R2109:C1s2 UTSW 6 124635045 missense probably damaging 0.96
R2197:C1s2 UTSW 6 124632110 missense probably damaging 1.00
R4421:C1s2 UTSW 6 124625215 missense probably benign 0.39
R4573:C1s2 UTSW 6 124628243 intron probably null
R4906:C1s2 UTSW 6 124635114 nonsense probably null
R4923:C1s2 UTSW 6 124625690 missense probably benign 0.00
R5030:C1s2 UTSW 6 124635588 missense possibly damaging 0.77
R5690:C1s2 UTSW 6 124631037 missense probably benign 0.13
R5708:C1s2 UTSW 6 124625743 nonsense probably null
R5846:C1s2 UTSW 6 124631164 missense probably damaging 1.00
R6176:C1s2 UTSW 6 124625809 missense probably damaging 1.00
R6177:C1s2 UTSW 6 124630001 missense probably damaging 0.96
R6842:C1s2 UTSW 6 124627502 missense probably benign 0.12
R7291:C1s2 UTSW 6 124625384 missense probably benign 0.16
X0062:C1s2 UTSW 6 124635090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTAATATACCTGCACTGAG -3'
(R):5'- ATGTGATTTCCCATTTCTCCAGAG -3'

Sequencing Primer
(F):5'- ACTGAGTCGTATGCACAGCTC -3'
(R):5'- TCTCCAGAGAGAGCTCAGATCTG -3'
Posted On2016-04-27