Incidental Mutation 'R4977:Psg29'
ID382756
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17208631 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 186 (G186R)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect probably damaging
Transcript: ENSMUST00000075934
AA Change: G186R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: G186R

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCCGCTCAGAACTGTGTCTC -3'
(R):5'- ATCTGTACCCAGTACTCGTAGG -3'

Sequencing Primer
(F):5'- ACTGATGGTGCCAATTTATTGTCTC -3'
(R):5'- CGTAGGGTGTATAATCCAGCATCC -3'
Posted On2016-04-27