Incidental Mutation 'R4977:Ggn'
ID382760
Institutional Source Beutler Lab
Gene Symbol Ggn
Ensembl Gene ENSMUSG00000031493
Gene Namegametogenetin
Synonyms
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29170210-29173976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29172196 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 334 (G334C)
Ref Sequence ENSEMBL: ENSMUSP00000146750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000059642] [ENSMUST00000098609] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209019] [ENSMUST00000209034]
Predicted Effect probably benign
Transcript: ENSMUST00000033886
SMART Domains Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059642
SMART Domains Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
Pfam:CSN8_PSD8_EIF3K 189 330 1.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098609
AA Change: G370C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493
AA Change: G370C

DomainStartEndE-ValueType
Pfam:GGN 38 342 2.1e-158 PFAM
Pfam:GGN 340 709 1.5e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130390
Predicted Effect probably benign
Transcript: ENSMUST00000182328
SMART Domains Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:SAC3_GANP 49 232 1.2e-37 PFAM
Pfam:PCI_Csn8 125 266 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186182
SMART Domains Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
Pfam:SAC3_GANP 113 296 1.3e-37 PFAM
Pfam:PCI_Csn8 189 330 2.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207087
Predicted Effect probably benign
Transcript: ENSMUST00000208288
Predicted Effect probably damaging
Transcript: ENSMUST00000208330
AA Change: G347C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208659
Predicted Effect probably damaging
Transcript: ENSMUST00000209019
AA Change: G334C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209034
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for this allele exhibit impaired double-strand break repair in spermatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Ggn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0302:Ggn UTSW 7 29171240 unclassified probably null
R0317:Ggn UTSW 7 29171090 start codon destroyed probably null
R0376:Ggn UTSW 7 29173022 missense possibly damaging 0.51
R0469:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0581:Ggn UTSW 7 29172304 missense probably benign 0.40
R1375:Ggn UTSW 7 29171941 missense probably damaging 0.97
R1956:Ggn UTSW 7 29171916 missense probably damaging 0.99
R2012:Ggn UTSW 7 29173763 unclassified probably null
R4436:Ggn UTSW 7 29171551 missense probably damaging 0.98
R4444:Ggn UTSW 7 29172160 missense probably benign 0.06
R5762:Ggn UTSW 7 29172352 missense probably damaging 0.98
R5822:Ggn UTSW 7 29172556 missense probably damaging 0.97
R6180:Ggn UTSW 7 29173049 missense probably damaging 0.98
R6294:Ggn UTSW 7 29173848 missense possibly damaging 0.92
R6667:Ggn UTSW 7 29172668 missense possibly damaging 0.71
R6963:Ggn UTSW 7 29171582 missense probably damaging 0.99
R7084:Ggn UTSW 7 29172998 missense probably damaging 0.97
R7242:Ggn UTSW 7 29173034 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCTGGGGCCATCTCCTATG -3'
(R):5'- CTGAAGATGGATGTGTCTGACC -3'

Sequencing Primer
(F):5'- ATCTCCTATGCTGAGGTCCTGAAG -3'
(R):5'- AAGATGGATGTGTCTGACCTGACC -3'
Posted On2016-04-27