Incidental Mutation 'R4977:Fam160a2'
ID382767
Institutional Source Beutler Lab
Gene Symbol Fam160a2
Ensembl Gene ENSMUSG00000044465
Gene Namefamily with sequence similarity 160, member A2
Synonyms4632419K20Rik, 6530415H11Rik
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105371211-105400054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105389335 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 232 (D232E)
Ref Sequence ENSEMBL: ENSMUSP00000137163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048079] [ENSMUST00000074686] [ENSMUST00000118726] [ENSMUST00000122327] [ENSMUST00000137158] [ENSMUST00000179474] [ENSMUST00000211549]
Predicted Effect probably damaging
Transcript: ENSMUST00000048079
AA Change: D232E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045084
Gene: ENSMUSG00000044465
AA Change: D232E

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 2.8e-99 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074686
AA Change: D232E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074252
Gene: ENSMUSG00000044465
AA Change: D232E

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.4e-100 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 825 840 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118726
AA Change: D232E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112605
Gene: ENSMUSG00000044465
AA Change: D232E

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 1.8e-99 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122327
AA Change: D232E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112711
Gene: ENSMUSG00000044465
AA Change: D232E

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 5.6e-98 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136298
Predicted Effect probably damaging
Transcript: ENSMUST00000137158
AA Change: D232E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119184
Gene: ENSMUSG00000044465
AA Change: D232E

DomainStartEndE-ValueType
Pfam:RAI16-like 96 259 7.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179474
AA Change: D232E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465
AA Change: D232E

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211013
Predicted Effect probably benign
Transcript: ENSMUST00000211549
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the FTS/Hook/FHIP (FHF) complex, which can interact with members of the homotypic vesicular protein sorting (HOPS) complex. This interaction suggests that the encoded protein is involved in vesicle trafficking. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Clcn4 T A 7: 7,291,437 I411F probably benign Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Fam160a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Fam160a2 APN 7 105388260 missense probably damaging 1.00
IGL01972:Fam160a2 APN 7 105390145 missense probably damaging 0.99
IGL02054:Fam160a2 APN 7 105384423 missense probably damaging 1.00
IGL03037:Fam160a2 APN 7 105379086 missense probably benign 0.04
IGL03278:Fam160a2 APN 7 105385124 missense possibly damaging 0.93
IGL03340:Fam160a2 APN 7 105389310 missense probably damaging 1.00
IGL03374:Fam160a2 APN 7 105383951 missense probably damaging 1.00
R0426:Fam160a2 UTSW 7 105389473 missense probably damaging 1.00
R0482:Fam160a2 UTSW 7 105384212 missense possibly damaging 0.87
R0586:Fam160a2 UTSW 7 105389447 missense probably damaging 1.00
R0686:Fam160a2 UTSW 7 105388309 missense probably damaging 1.00
R1617:Fam160a2 UTSW 7 105385062 missense probably damaging 1.00
R2025:Fam160a2 UTSW 7 105388936 missense probably damaging 1.00
R2042:Fam160a2 UTSW 7 105384121 nonsense probably null
R2049:Fam160a2 UTSW 7 105389839 missense probably damaging 1.00
R2201:Fam160a2 UTSW 7 105388191 missense probably damaging 1.00
R3778:Fam160a2 UTSW 7 105388228 missense probably damaging 1.00
R4094:Fam160a2 UTSW 7 105388218 missense probably damaging 1.00
R4348:Fam160a2 UTSW 7 105385349 missense probably damaging 1.00
R4482:Fam160a2 UTSW 7 105389674 missense probably benign 0.06
R4609:Fam160a2 UTSW 7 105388224 missense probably damaging 1.00
R4742:Fam160a2 UTSW 7 105384311 missense probably damaging 0.99
R5642:Fam160a2 UTSW 7 105389882 missense probably damaging 1.00
R6404:Fam160a2 UTSW 7 105384991 nonsense probably null
R6906:Fam160a2 UTSW 7 105388269 missense probably damaging 1.00
R7053:Fam160a2 UTSW 7 105384572 missense probably damaging 1.00
R7265:Fam160a2 UTSW 7 105384225 missense probably benign 0.00
X0022:Fam160a2 UTSW 7 105389709 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCAACACCAGGAGTTGC -3'
(R):5'- GATGAAGGCCTGGTGCTACTTC -3'

Sequencing Primer
(F):5'- TCTGAAGTAAAGGGCCCTCC -3'
(R):5'- TCTCAGCCAACTGTGCGTG -3'
Posted On2016-04-27