Incidental Mutation 'R0320:Cit'
ID38277
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission 038530-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0320 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115979445 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 1227 (L1227M)
Ref Sequence ENSEMBL: ENSMUSP00000099620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051704
AA Change: L1227M

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: L1227M

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102560
AA Change: L1227M

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: L1227M

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112008
AA Change: L1185M

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: L1185M

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122877
Predicted Effect probably benign
Transcript: ENSMUST00000123736
Predicted Effect possibly damaging
Transcript: ENSMUST00000141101
AA Change: L1185M

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: L1185M

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,614 T465A probably benign Het
9430007A20Rik A T 4: 144,522,420 H119L probably damaging Het
A430110L20Rik T G 1: 181,227,422 noncoding transcript Het
Abcb10 C T 8: 123,963,007 R439Q probably benign Het
Abcb8 T C 5: 24,400,790 S199P probably damaging Het
Adam8 C A 7: 139,986,442 C556F probably damaging Het
Akap11 T C 14: 78,513,379 T523A probably benign Het
Aldh3b1 T C 19: 3,918,999 probably benign Het
Arhgap30 T A 1: 171,403,804 W230R possibly damaging Het
Atp8b4 A G 2: 126,459,694 I82T possibly damaging Het
Bptf A T 11: 107,072,819 L1850I probably damaging Het
C4b C A 17: 34,733,161 V1237L probably benign Het
Calu C A 6: 29,374,551 probably benign Het
Ccdc129 T C 6: 55,976,447 I916T probably damaging Het
Col4a1 C T 8: 11,242,782 probably null Het
Cp T C 3: 19,974,848 probably benign Het
Cpd T C 11: 76,840,447 D311G possibly damaging Het
Ctc1 T A 11: 69,033,537 S972T probably damaging Het
Dnah17 A G 11: 118,052,674 F3201L possibly damaging Het
Dopey2 C A 16: 93,810,147 R2113S probably benign Het
Dym T A 18: 75,199,262 D520E probably damaging Het
Eif5a G T 11: 69,917,479 T64K probably benign Het
Flt3 A T 5: 147,369,579 probably benign Het
Ints6 A T 14: 62,707,635 Y415* probably null Het
Itga1 A G 13: 114,977,594 probably benign Het
Itgae A G 11: 73,130,999 H902R possibly damaging Het
Kdm5a T C 6: 120,389,620 I406T probably benign Het
Lmx1a C T 1: 167,791,404 Q111* probably null Het
Lrrc25 T C 8: 70,618,246 Y226H probably benign Het
Mcam T A 9: 44,140,186 N447K possibly damaging Het
Mcm10 A T 2: 5,004,086 D357E probably benign Het
Nrip1 T C 16: 76,292,363 T769A probably benign Het
Ofcc1 G C 13: 40,206,696 Q286E probably benign Het
Olfr382 T G 11: 73,516,924 I92L probably damaging Het
Olfr689 A T 7: 105,314,654 I217F probably benign Het
Parp3 T A 9: 106,475,812 N55I possibly damaging Het
Parp4 T C 14: 56,588,496 probably null Het
Pilrb1 G A 5: 137,854,998 T181I probably benign Het
Ppm1n A G 7: 19,278,356 V317A probably damaging Het
Prdm2 A T 4: 143,179,351 F55L probably damaging Het
Psd2 C T 18: 35,979,644 R131C probably damaging Het
Ralgps1 A T 2: 33,141,015 C570S possibly damaging Het
Scaf8 T C 17: 3,178,255 S443P unknown Het
Setd5 A G 6: 113,111,481 K190R probably damaging Het
Spsb4 T A 9: 96,996,108 H54L probably damaging Het
St7l T A 3: 104,870,913 L122* probably null Het
Stom C T 2: 35,321,634 R125H probably damaging Het
Tigd4 T A 3: 84,595,174 V466E probably benign Het
Tmc3 A C 7: 83,607,819 probably benign Het
Vcl C T 14: 20,985,624 probably benign Het
Vmn1r168 G A 7: 23,541,342 R208H probably benign Het
Vmn2r75 C A 7: 86,165,080 V402L probably benign Het
Vps13b A T 15: 35,674,828 H1698L probably damaging Het
Wnt16 T G 6: 22,297,993 V286G possibly damaging Het
Xirp1 C A 9: 120,016,467 V1117L probably benign Het
Zfp788 C T 7: 41,649,547 H536Y probably damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 unclassified probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GAGGAGTTGCTCTCACAAGGGAAC -3'
(R):5'- TGTCGGAGTGCCAAACAACCAAAG -3'

Sequencing Primer
(F):5'- TTCCTGCATCACTCGGGAAG -3'
(R):5'- GTGCCAAACAACCAAAGGACAG -3'
Posted On2013-05-23